HUGE

Gene/Protein Characteristic Table for KIAA0406

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01084
Accession No. :	AB007866
Description :
HUGO Gene Name :
Clone Name :	hg01335s1 [Vector Info]
Flexi ORF Clone :	pF1KA0406
Source :	Human adult brain
Note :	We replaced hg01335, former representative clones for KIAA0406 with hg01335s1. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 3899 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 434 bp

Genome contig ID gi51511747r_35944838
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
CAAACGGAAATAAAGACACTTCTTGGATGAAAAGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGATCAAAAGCTCACTTTGAAGTTTTTTATTTAAACTGGGTGGTTTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 r 36044838 36080962 8 99.8 Terminal No-hit

Features of the protein sequence	Description

Length: 1095 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAH89980	97.7	hypothetical pr...	Pongo abelii
XP_001090176	97.1	hypothetical pr...	Macaca mulatta
ABG67032	85.2	hypothetical pr...	Bos taurus
AAI26509	85.1	Hypothetical pr...	Bos taurus
AAH53067	85.0	RIKEN cDNA 2610...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CAGGGAGGTGTATGCAGATGG

Primer_r
: ATTGTCTGGTGGCTCTAAGGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CAGGGAGGTGTATGCAGATGG
Primer_r	: ATTGTCTGGTGGCTCTAAGGG
PCR product length	: 124 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	434 bp
Genome contig ID	gi51511747r_35944838
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- CAAACGGAAATAAAGACACTTCTTGGATGAAAAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGATCAAAAGCTCACTTTGAAGTTTTTTATTTAAACTGGGTGGTTTTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	r	36044838	36080962	8	99.8	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0406

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information