HUGE

Gene/Protein Characteristic Table for KIAA0420

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00532
Accession No. :	AB007880
Description :	SEC14-like 5.
HUGO Gene Name :	SEC14-like 5 (S. cerevisiae) (SEC14L5)
Clone Name :	fg02987 [Vector Info]
Flexi ORF Clone :	pF1KSDA0420
Source :	Human fetal brain
Note :	We replaced hh01118, former representative clones for KIAA0420 with fg02987. (2001/5/29)

Features of the cloned DNA sequence	Description

Length: 6453 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4182 bp

Genome contig ID gi51511732f_4848319
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GTGCTCCAACACGAGTTCGTAAACTTTCTTAAAAT
Flanking genome sequence
(160837 - 160886)
----+----*----+----*----+----*----+----*----+----*
ACTGAGGTTTTTTGTGTGTGTGTTTTCTTTGTTTTTTCAGCTCATCAGCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 4948319 5009154 16 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 756 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001098962	95.4	SEC14 (S. cerev...	Macaca mulatta
O43304	100.0	SEC14-like prot...	Homo sapiens
XP_547140	91.1	similar to SEC1...	Canis lupus fam...
AAI57908	88.1	SEC14-like 5 (S...	Mus musculus
XP_220173	88.1	similar to SEC1...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033012	7.1e-35	33.9	KIAA1186

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001071 326 348 PR00180 Cellular retinaldehyde binding/alpha-tocopherol transport

IPR001071 459 480 PR00180 Cellular retinaldehyde binding/alpha-tocopherol transport

IPR001071 492 511 PR00180 Cellular retinaldehyde binding/alpha-tocopherol transport

HMMPfam IPR006797 77 233 PF04707 MSF1

IPR008273 293 360 PF03765 Cellular retinaldehyde-binding/triple function

IPR001251 375 563 PF00650 Cellular retinaldehyde-binding/triple function

HMMSmart IPR001251 366 539 SM00516 Cellular retinaldehyde-binding/triple function

ProfileScan IPR006797 62 235 PS50904 MSF1

IPR001251 366 542 PS50191 Cellular retinaldehyde-binding/triple function

IPR009038 569 713 PS50866 GOLD

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001071	326	348	PR00180	Cellular retinaldehyde binding/alpha-tocopherol transport
IPR001071	459	480	PR00180	Cellular retinaldehyde binding/alpha-tocopherol transport
IPR001071	492	511	PR00180	Cellular retinaldehyde binding/alpha-tocopherol transport
HMMPfam	IPR006797	77	233	PF04707	MSF1
IPR008273	293	360	PF03765	Cellular retinaldehyde-binding/triple function
IPR001251	375	563	PF00650	Cellular retinaldehyde-binding/triple function
HMMSmart	IPR001251	366	539	SM00516	Cellular retinaldehyde-binding/triple function
ProfileScan	IPR006797	62	235	PS50904	MSF1
IPR001251	366	542	PS50191	Cellular retinaldehyde-binding/triple function
IPR009038	569	713	PS50866	GOLD

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTCTTGAACGAGCCCACGGGA

Primer_r
: GTTTGCCTGATCACTTGCTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTCTTGAACGAGCCCACGGGA
Primer_r	: GTTTGCCTGATCACTTGCTCC
PCR product length	: 104 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4182 bp
Genome contig ID	gi51511732f_4848319
PolyA signal sequence (None)	+--------+--------+----*----+---- GTGCTCCAACACGAGTTCGTAAACTTTCTTAAAAT
Flanking genome sequence (160837 - 160886)	----+--------+--------+--------+--------+----* ACTGAGGTTTTTTGTGTGTGTGTTTTCTTTGTTTTTTCAGCTCATCAGCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	4948319	5009154	16	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0420

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information