HUGE |
Gene/Protein Characteristic Table for KIAA1186 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | |
Product ID : | ORK00757 |
---|---|
Accession No. : | AB033012 |
Description : | SEC14-like protein 2. |
HUGO Gene Name : | SEC14-like 2 (S. cerevisiae) (SEC14L2) |
Clone Name : | pj00504 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1186
![]() |
Source : | Human brain (hippocampus) |
Note : | We replaced hg02441a, former representative clones for KIAA1186 with pj00504. (1999/11/11) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4168 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2881 bp Genome contig ID gi89161203f_29023031 PolyA signal sequence
(AATAAA,-10) +----*----+----*----+----*----+----
GAACATGTAGACTGGCAATAAACTCAATAAATGGTFlanking genome sequence
(128247 - 128296) ----+----*----+----*----+----*----+----*----+----*
GACTGTTATAATTAATCCTCGGAACCATCCTAGGGAGTGGACACTATTGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 f 29123031 29151276 12 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 405 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |