| HUGE |
Gene/Protein Characteristic Table for KIAA0426 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00534 |
|---|---|
| Accession No. : | AB007886 |
| Description : | Zinc finger and SCAN domain-containing protein 12. |
| HUGO Gene Name : | zinc finger and SCAN domain containing 12 (ZSCAN12) |
| Clone Name : | hh01274 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0426
|
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5471 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3511 bp Genome contig ID gi89161210r_28354711 PolyA signal sequence
(AATAAA,-26)
GGTATTATTAATAAATTCATTATTTTCAAAGATGGFlanking genome sequence
(100000 - 99951)
ACTGTGTTCTGTAAAAAGCTTTTCCAGTATCTGCAAATCACACAGTTTTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 r 28454711 28475490 7 99.1 Internal No-hit
Features of the protein sequence |
Description | |
|---|---|---|
Length: 613 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : TGGTTCCTGTATTTAGTGCCC | |
| : CAACAAGTTGATAATGTAGCC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 6 |
| : GeneBridge 4 | |
| : TGGTTCCTGTATTTAGTGCCC | |
| : CAACAAGTTGATAATGTAGCC | |
| : 179 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
