HUGE

Gene/Protein Characteristic Table for KIAA0426

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00534
Accession No. :	AB007886
Description :	Zinc finger and SCAN domain-containing protein 12.
HUGO Gene Name :	zinc finger and SCAN domain containing 12 (ZSCAN12)
Clone Name :	hh01274 [Vector Info]
Flexi ORF Clone :	pF1KSDA0426
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5471 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3511 bp

Genome contig ID gi89161210r_28354711
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
GGTATTATTAATAAATTCATTATTTTCAAAGATGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTGTGTTCTGTAAAAAGCTTTTCCAGTATCTGCAAATCACACAGTTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 28454711 28475490 7 99.1 Internal No-hit

Features of the protein sequence	Description

Length: 613 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAF82491	99.8	unnamed protein...	Homo sapiens
ABZ92462	99.8	zinc finger and...	synthetic construct
A2T6V8	98.8	Zinc finger and...	Pan troglodytes
A1YFW2	99.0	Zinc finger and...	Pan paniscus
A1YEP8	99.0	Zinc finger and...	Gorilla gorilla...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046831	1.6e-49	53.8	KIAA1611
AB040941	7.1e-48	44.0	KIAA1508
AB014528	3.9e-47	53.1	KIAA0628
AB107355	5.8e-47	42.9	KIAA2033
AB075827	7.1e-47	41.7	KIAA1947

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 283 306 PD000003 Zinc finger

IPR007087 311 334 PD000003 Zinc finger

IPR007087 339 362 PD000003 Zinc finger

IPR007087 367 390 PD000003 Zinc finger

IPR007087 395 418 PD000003 Zinc finger

IPR007087 423 445 PD000003 Zinc finger

IPR007087 451 473 PD000003 Zinc finger

IPR007087 478 501 PD000003 Zinc finger

IPR007087 506 529 PD000003 Zinc finger

IPR007087 534 557 PD000003 Zinc finger

HMMPfam IPR003309 49 144 PF02023 Transcriptional regulator SCAN

IPR007087 283 305 PF00096 Zinc finger

IPR007087 311 333 PF00096 Zinc finger

IPR007087 339 361 PF00096 Zinc finger

IPR007087 367 389 PF00096 Zinc finger

IPR007087 395 417 PF00096 Zinc finger

IPR007087 423 445 PF00096 Zinc finger

IPR007087 451 472 PF00096 Zinc finger

IPR007087 478 500 PF00096 Zinc finger

IPR007087 506 528 PF00096 Zinc finger

IPR007087 534 556 PF00096 Zinc finger

HMMSmart IPR003309 51 163 SM00431 Transcriptional regulator SCAN

IPR015880 283 305 SM00355 Zinc finger

IPR015880 311 333 SM00355 Zinc finger

IPR015880 339 361 SM00355 Zinc finger

IPR015880 367 389 SM00355 Zinc finger

IPR015880 395 417 SM00355 Zinc finger

IPR015880 423 445 SM00355 Zinc finger

IPR015880 451 472 SM00355 Zinc finger

IPR015880 478 500 SM00355 Zinc finger

IPR015880 506 528 SM00355 Zinc finger

IPR015880 534 556 SM00355 Zinc finger

ProfileScan IPR003309 55 137 PS50804 Transcriptional regulator SCAN

IPR007087 283 310 PS50157 Zinc finger

IPR007087 311 338 PS50157 Zinc finger

IPR007087 339 366 PS50157 Zinc finger

IPR007087 367 394 PS50157 Zinc finger

IPR007087 395 422 PS50157 Zinc finger

IPR007087 423 450 PS50157 Zinc finger

IPR007087 451 477 PS50157 Zinc finger

IPR007087 478 505 PS50157 Zinc finger

IPR007087 506 533 PS50157 Zinc finger

IPR007087 534 561 PS50157 Zinc finger

IPR007087 562 592 PS50157 Zinc finger

ScanRegExp IPR007087 285 305 PS00028 Zinc finger

IPR007087 313 333 PS00028 Zinc finger

IPR007087 341 361 PS00028 Zinc finger

IPR007087 369 389 PS00028 Zinc finger

IPR007087 397 417 PS00028 Zinc finger

IPR007087 425 446 PS00028 Zinc finger

IPR007087 480 500 PS00028 Zinc finger

IPR007087 508 528 PS00028 Zinc finger

IPR007087 536 556 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	283	306	PD000003	Zinc finger
IPR007087	311	334	PD000003	Zinc finger
IPR007087	339	362	PD000003	Zinc finger
IPR007087	367	390	PD000003	Zinc finger
IPR007087	395	418	PD000003	Zinc finger
IPR007087	423	445	PD000003	Zinc finger
IPR007087	451	473	PD000003	Zinc finger
IPR007087	478	501	PD000003	Zinc finger
IPR007087	506	529	PD000003	Zinc finger
IPR007087	534	557	PD000003	Zinc finger
HMMPfam	IPR003309	49	144	PF02023	Transcriptional regulator SCAN
IPR007087	283	305	PF00096	Zinc finger
IPR007087	311	333	PF00096	Zinc finger
IPR007087	339	361	PF00096	Zinc finger
IPR007087	367	389	PF00096	Zinc finger
IPR007087	395	417	PF00096	Zinc finger
IPR007087	423	445	PF00096	Zinc finger
IPR007087	451	472	PF00096	Zinc finger
IPR007087	478	500	PF00096	Zinc finger
IPR007087	506	528	PF00096	Zinc finger
IPR007087	534	556	PF00096	Zinc finger
HMMSmart	IPR003309	51	163	SM00431	Transcriptional regulator SCAN
IPR015880	283	305	SM00355	Zinc finger
IPR015880	311	333	SM00355	Zinc finger
IPR015880	339	361	SM00355	Zinc finger
IPR015880	367	389	SM00355	Zinc finger
IPR015880	395	417	SM00355	Zinc finger
IPR015880	423	445	SM00355	Zinc finger
IPR015880	451	472	SM00355	Zinc finger
IPR015880	478	500	SM00355	Zinc finger
IPR015880	506	528	SM00355	Zinc finger
IPR015880	534	556	SM00355	Zinc finger
ProfileScan	IPR003309	55	137	PS50804	Transcriptional regulator SCAN
IPR007087	283	310	PS50157	Zinc finger
IPR007087	311	338	PS50157	Zinc finger
IPR007087	339	366	PS50157	Zinc finger
IPR007087	367	394	PS50157	Zinc finger
IPR007087	395	422	PS50157	Zinc finger
IPR007087	423	450	PS50157	Zinc finger
IPR007087	451	477	PS50157	Zinc finger
IPR007087	478	505	PS50157	Zinc finger
IPR007087	506	533	PS50157	Zinc finger
IPR007087	534	561	PS50157	Zinc finger
IPR007087	562	592	PS50157	Zinc finger
ScanRegExp	IPR007087	285	305	PS00028	Zinc finger
IPR007087	313	333	PS00028	Zinc finger
IPR007087	341	361	PS00028	Zinc finger
IPR007087	369	389	PS00028	Zinc finger
IPR007087	397	417	PS00028	Zinc finger
IPR007087	425	446	PS00028	Zinc finger
IPR007087	480	500	PS00028	Zinc finger
IPR007087	508	528	PS00028	Zinc finger
IPR007087	536	556	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TGGTTCCTGTATTTAGTGCCC

Primer_r
: CAACAAGTTGATAATGTAGCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGGTTCCTGTATTTAGTGCCC
Primer_r	: CAACAAGTTGATAATGTAGCC
PCR product length	: 179 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3511 bp
Genome contig ID	gi89161210r_28354711
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- GGTATTATTAATAAATTCATTATTTTCAAAGATGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTGTGTTCTGTAAAAAGCTTTTCCAGTATCTGCAAATCACACAGTTTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	28454711	28475490	7	99.1	Internal No-hit

Gene/Protein Characteristic Table for KIAA0426

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information