HUGE

Gene/Protein Characteristic Table for KIAA1508

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07491
Accession No. :	AB040941
Description :	zinc finger protein 530.
HUGO Gene Name :	zinc finger protein 530 (ZNF530)
Clone Name :	hk06576 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4368 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1697 bp

Genome contig ID gi42406306f_62707835
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAGCCTGGGTGACAGAGCGAGACTGCGTCTC
Flanking genome sequence
(104368 - 104417)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAGATCCATTCAGGCCAGTCACAGTGGCTCATGCG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 62807835 62812201 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 573 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW72517	99.8	zinc finger pro...	Homo sapiens
AAC24609	99.6	R28830_2 [Homo ...	Homo sapiens
Q6P9A1	99.6	Zinc finger pro...	Homo sapiens
AAH60865	99.6	Zinc finger pro...	Homo sapiens
BAG53369	99.5	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075836	2.2e-88	51.0	KIAA1956
AB075827	1e-72	48.7	KIAA1947
AB002324	7.3e-72	55.0	KIAA0326
D31763	9.8e-71	44.7	KIAA0065
AB046831	1.1e-70	45.7	KIAA1611

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 213 235 PD000003 Zinc finger

IPR007087 241 264 PD000003 Zinc finger

IPR007087 269 292 PD000003 Zinc finger

IPR007087 297 320 PD000003 Zinc finger

IPR007087 325 348 PD000003 Zinc finger

IPR007087 353 376 PD000003 Zinc finger

IPR007087 381 404 PD000003 Zinc finger

IPR007087 409 432 PD000003 Zinc finger

IPR007087 437 460 PD000003 Zinc finger

IPR007087 465 488 PD000003 Zinc finger

IPR007087 493 516 PD000003 Zinc finger

IPR007087 521 544 PD000003 Zinc finger

IPR007087 549 571 PD000003 Zinc finger

HMMPfam IPR007087 213 235 PF00096 Zinc finger

IPR007087 241 263 PF00096 Zinc finger

IPR007087 269 291 PF00096 Zinc finger

IPR007087 297 319 PF00096 Zinc finger

IPR007087 325 347 PF00096 Zinc finger

IPR007087 353 375 PF00096 Zinc finger

IPR007087 381 403 PF00096 Zinc finger

IPR007087 409 431 PF00096 Zinc finger

IPR007087 437 459 PF00096 Zinc finger

IPR007087 465 487 PF00096 Zinc finger

IPR007087 493 515 PF00096 Zinc finger

IPR007087 521 543 PF00096 Zinc finger

IPR007087 549 571 PF00096 Zinc finger

HMMSmart IPR015880 213 235 SM00355 Zinc finger

IPR015880 241 263 SM00355 Zinc finger

IPR015880 269 291 SM00355 Zinc finger

IPR015880 297 319 SM00355 Zinc finger

IPR015880 325 347 SM00355 Zinc finger

IPR015880 353 375 SM00355 Zinc finger

IPR015880 381 403 SM00355 Zinc finger

IPR015880 409 431 SM00355 Zinc finger

IPR015880 437 459 SM00355 Zinc finger

IPR015880 465 487 SM00355 Zinc finger

IPR015880 493 515 SM00355 Zinc finger

IPR015880 521 543 SM00355 Zinc finger

IPR015880 549 571 SM00355 Zinc finger

ProfileScan IPR007087 213 240 PS50157 Zinc finger

IPR007087 241 268 PS50157 Zinc finger

IPR007087 269 296 PS50157 Zinc finger

IPR007087 297 324 PS50157 Zinc finger

IPR007087 325 352 PS50157 Zinc finger

IPR007087 353 380 PS50157 Zinc finger

IPR007087 381 408 PS50157 Zinc finger

IPR007087 409 436 PS50157 Zinc finger

IPR007087 437 464 PS50157 Zinc finger

IPR007087 465 492 PS50157 Zinc finger

IPR007087 493 520 PS50157 Zinc finger

IPR007087 521 548 PS50157 Zinc finger

IPR007087 549 573 PS50157 Zinc finger

ScanRegExp IPR007087 215 235 PS00028 Zinc finger

IPR007087 243 263 PS00028 Zinc finger

IPR007087 271 291 PS00028 Zinc finger

IPR007087 299 319 PS00028 Zinc finger

IPR007087 327 347 PS00028 Zinc finger

IPR007087 355 375 PS00028 Zinc finger

IPR007087 383 403 PS00028 Zinc finger

IPR007087 411 431 PS00028 Zinc finger

IPR007087 439 459 PS00028 Zinc finger

IPR007087 467 487 PS00028 Zinc finger

IPR007087 495 515 PS00028 Zinc finger

IPR007087 523 543 PS00028 Zinc finger

IPR007087 551 571 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	213	235	PD000003	Zinc finger
IPR007087	241	264	PD000003	Zinc finger
IPR007087	269	292	PD000003	Zinc finger
IPR007087	297	320	PD000003	Zinc finger
IPR007087	325	348	PD000003	Zinc finger
IPR007087	353	376	PD000003	Zinc finger
IPR007087	381	404	PD000003	Zinc finger
IPR007087	409	432	PD000003	Zinc finger
IPR007087	437	460	PD000003	Zinc finger
IPR007087	465	488	PD000003	Zinc finger
IPR007087	493	516	PD000003	Zinc finger
IPR007087	521	544	PD000003	Zinc finger
IPR007087	549	571	PD000003	Zinc finger
HMMPfam	IPR007087	213	235	PF00096	Zinc finger
IPR007087	241	263	PF00096	Zinc finger
IPR007087	269	291	PF00096	Zinc finger
IPR007087	297	319	PF00096	Zinc finger
IPR007087	325	347	PF00096	Zinc finger
IPR007087	353	375	PF00096	Zinc finger
IPR007087	381	403	PF00096	Zinc finger
IPR007087	409	431	PF00096	Zinc finger
IPR007087	437	459	PF00096	Zinc finger
IPR007087	465	487	PF00096	Zinc finger
IPR007087	493	515	PF00096	Zinc finger
IPR007087	521	543	PF00096	Zinc finger
IPR007087	549	571	PF00096	Zinc finger
HMMSmart	IPR015880	213	235	SM00355	Zinc finger
IPR015880	241	263	SM00355	Zinc finger
IPR015880	269	291	SM00355	Zinc finger
IPR015880	297	319	SM00355	Zinc finger
IPR015880	325	347	SM00355	Zinc finger
IPR015880	353	375	SM00355	Zinc finger
IPR015880	381	403	SM00355	Zinc finger
IPR015880	409	431	SM00355	Zinc finger
IPR015880	437	459	SM00355	Zinc finger
IPR015880	465	487	SM00355	Zinc finger
IPR015880	493	515	SM00355	Zinc finger
IPR015880	521	543	SM00355	Zinc finger
IPR015880	549	571	SM00355	Zinc finger
ProfileScan	IPR007087	213	240	PS50157	Zinc finger
IPR007087	241	268	PS50157	Zinc finger
IPR007087	269	296	PS50157	Zinc finger
IPR007087	297	324	PS50157	Zinc finger
IPR007087	325	352	PS50157	Zinc finger
IPR007087	353	380	PS50157	Zinc finger
IPR007087	381	408	PS50157	Zinc finger
IPR007087	409	436	PS50157	Zinc finger
IPR007087	437	464	PS50157	Zinc finger
IPR007087	465	492	PS50157	Zinc finger
IPR007087	493	520	PS50157	Zinc finger
IPR007087	521	548	PS50157	Zinc finger
IPR007087	549	573	PS50157	Zinc finger
ScanRegExp	IPR007087	215	235	PS00028	Zinc finger
IPR007087	243	263	PS00028	Zinc finger
IPR007087	271	291	PS00028	Zinc finger
IPR007087	299	319	PS00028	Zinc finger
IPR007087	327	347	PS00028	Zinc finger
IPR007087	355	375	PS00028	Zinc finger
IPR007087	383	403	PS00028	Zinc finger
IPR007087	411	431	PS00028	Zinc finger
IPR007087	439	459	PS00028	Zinc finger
IPR007087	467	487	PS00028	Zinc finger
IPR007087	495	515	PS00028	Zinc finger
IPR007087	523	543	PS00028	Zinc finger
IPR007087	551	571	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 13 HTIVNLCFLSISLLSGCWCGAVD 35 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	13	HTIVNLCFLSISLLSGCWCGAVD	35	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCCCTGCAATGTTTAGAATCC

Primer_r
: TCCCTATTATTCAACCCAGCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCCCTGCAATGTTTAGAATCC
Primer_r	: TCCCTATTATTCAACCCAGCG
PCR product length	: 153 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1697 bp
Genome contig ID	gi42406306f_62707835
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGGGTGACAGAGCGAGACTGCGTCTC
Flanking genome sequence (104368 - 104417)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAGATCCATTCAGGCCAGTCACAGTGGCTCATGCG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	62807835	62812201	1	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1508

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information