HUGE |
Gene/Protein Characteristic Table for KIAA1956 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00954 |
---|---|
Accession No. : | AB075836 |
Description : | Zinc finger protein 418. |
HUGO Gene Name : | zinc finger protein 418 (ZNF418) |
Clone Name : | fk08713 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1956
![]() |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3543 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1371 bp Genome contig ID gi42406306r_63025198 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
GTATCTAAGTCCTCAATAAACCCTATGTCTCATTTFlanking genome sequence
(99866 - 99817) ----+----*----+----*----+----*----+----*----+----*
TCTTTCTTTCTTTCTTTTTTGAGATGGAGTTTCGCTCCTGTTGCCCAGGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 19 r 63125064 63137143 5 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 680 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ATCAGGGGACACATCACAAGC | |
: CCTCTGACACATGGAACTTAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 19 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |