| HUGE |
Gene/Protein Characteristic Table for KIAA1349 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00811 |
|---|---|
| Accession No. : | AB037770 |
| Description : | Zinc finger protein 624. |
| HUGO Gene Name : | zinc finger protein 624 (ZNF624) |
| Clone Name : | fj00940 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA1349
|
| Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4055 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1544 bp Genome contig ID gi51511734r_16364776 PolyA signal sequence
(ATTAAA,-18)
GAACCTGTAATATTTACATTAAAAGGAAAAATATTFlanking genome sequence
(100000 - 99951)
TTCGTTGTGCGTTTTATTTATTGGACACCTTCAATGTGCCAGGACCTACC
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 r 16464776 16474544 2 99.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 752 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : GCCTCCCTTAACCCTACCTTC | |
| : CCTAAGCTGGGGCAATCTCAC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 17 |
| : GeneBridge 4 | |
| : GCCTCCCTTAACCCTACCTTC | |
| : CCTAAGCTGGGGCAATCTCAC | |
| : 128 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
