HUGE

Gene/Protein Characteristic Table for KIAA1982

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB075862
Description :	zinc finger protein 721.
HUGO Gene Name :	zinc finger protein 721 (ZNF721)
Clone Name :	fk06527 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3500 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 1700 bp

Genome contig ID gi89161207r_323781
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
AACTTAATTTTTGAAATAAAAATTGTTATTGTGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATTTTTGTGCCGTGAATGAAGTGTTTTATTATGCCACCAACTTTCAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 r 423781 427284 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 599 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8TF20	100.0	Zinc finger pro...	Homo sapiens
NP_597731	100.0	zinc finger pro...	Homo sapiens
EAW82668	100.0	hCG1981959, iso...	Homo sapiens
XP_526499	99.3	zinc finger pro...	Pan troglodytes
XP_001136398	99.3	zinc finger pro...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046831	4.3e-114	58.3	KIAA1611
AB037770	1.6e-109	53.4	KIAA1349
AB107355	4.8e-96	50.3	KIAA2033
AB058774	4.3e-93	50.9	KIAA1871
AB075827	5.5e-84	45.2	KIAA1947

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 9 32 PD000003 Zinc finger

IPR007087 37 60 PD000003 Zinc finger

IPR007087 65 87 PD000003 Zinc finger

IPR007087 121 144 PD000003 Zinc finger

IPR007087 149 172 PD000003 Zinc finger

IPR007087 177 200 PD000003 Zinc finger

IPR007087 205 228 PD000003 Zinc finger

IPR007087 233 256 PD000003 Zinc finger

IPR007087 261 284 PD000003 Zinc finger

IPR007087 289 312 PD000003 Zinc finger

IPR007087 317 340 PD000003 Zinc finger

IPR007087 345 368 PD000003 Zinc finger

IPR007087 373 396 PD000003 Zinc finger

IPR007087 401 424 PD000003 Zinc finger

IPR007087 429 452 PD000003 Zinc finger

IPR007087 457 480 PD000003 Zinc finger

IPR007087 485 508 PD000003 Zinc finger

IPR007087 513 536 PD000003 Zinc finger

IPR007087 541 564 PD000003 Zinc finger

IPR007087 569 592 PD000003 Zinc finger

HMMPfam IPR007087 9 31 PF00096 Zinc finger

IPR007087 37 59 PF00096 Zinc finger

IPR007087 65 87 PF00096 Zinc finger

IPR007087 121 143 PF00096 Zinc finger

IPR007087 149 171 PF00096 Zinc finger

IPR007087 177 199 PF00096 Zinc finger

IPR007087 205 227 PF00096 Zinc finger

IPR007087 233 255 PF00096 Zinc finger

IPR007087 261 283 PF00096 Zinc finger

IPR007087 345 367 PF00096 Zinc finger

IPR007087 373 395 PF00096 Zinc finger

IPR007087 429 451 PF00096 Zinc finger

IPR007087 457 479 PF00096 Zinc finger

IPR007087 485 507 PF00096 Zinc finger

IPR007087 513 535 PF00096 Zinc finger

IPR007087 541 563 PF00096 Zinc finger

IPR007087 569 591 PF00096 Zinc finger

HMMSmart IPR015880 9 31 SM00355 Zinc finger

IPR015880 37 59 SM00355 Zinc finger

IPR015880 65 87 SM00355 Zinc finger

IPR015880 121 143 SM00355 Zinc finger

IPR015880 149 171 SM00355 Zinc finger

IPR015880 177 199 SM00355 Zinc finger

IPR015880 205 227 SM00355 Zinc finger

IPR015880 233 255 SM00355 Zinc finger

IPR015880 261 283 SM00355 Zinc finger

IPR015880 317 337 SM00355 Zinc finger

IPR015880 345 367 SM00355 Zinc finger

IPR015880 373 395 SM00355 Zinc finger

IPR015880 429 451 SM00355 Zinc finger

IPR015880 457 479 SM00355 Zinc finger

IPR015880 485 507 SM00355 Zinc finger

IPR015880 513 535 SM00355 Zinc finger

IPR015880 541 563 SM00355 Zinc finger

IPR015880 569 591 SM00355 Zinc finger

ProfileScan IPR007087 9 36 PS50157 Zinc finger

IPR007087 37 64 PS50157 Zinc finger

IPR007087 65 92 PS50157 Zinc finger

IPR007087 93 120 PS50157 Zinc finger

IPR007087 121 148 PS50157 Zinc finger

IPR007087 149 176 PS50157 Zinc finger

IPR007087 177 204 PS50157 Zinc finger

IPR007087 205 232 PS50157 Zinc finger

IPR007087 233 260 PS50157 Zinc finger

IPR007087 261 288 PS50157 Zinc finger

IPR007087 289 316 PS50157 Zinc finger

IPR007087 317 344 PS50157 Zinc finger

IPR007087 345 372 PS50157 Zinc finger

IPR007087 373 400 PS50157 Zinc finger

IPR007087 401 428 PS50157 Zinc finger

IPR007087 429 456 PS50157 Zinc finger

IPR007087 457 484 PS50157 Zinc finger

IPR007087 485 512 PS50157 Zinc finger

IPR007087 513 540 PS50157 Zinc finger

IPR007087 541 568 PS50157 Zinc finger

IPR007087 569 596 PS50157 Zinc finger

ScanRegExp IPR007087 11 31 PS00028 Zinc finger

IPR007087 39 59 PS00028 Zinc finger

IPR007087 67 87 PS00028 Zinc finger

IPR007087 123 143 PS00028 Zinc finger

IPR007087 151 171 PS00028 Zinc finger

IPR007087 179 199 PS00028 Zinc finger

IPR007087 207 227 PS00028 Zinc finger

IPR007087 235 255 PS00028 Zinc finger

IPR007087 263 283 PS00028 Zinc finger

IPR007087 347 367 PS00028 Zinc finger

IPR007087 375 395 PS00028 Zinc finger

IPR007087 431 451 PS00028 Zinc finger

IPR007087 459 479 PS00028 Zinc finger

IPR007087 487 507 PS00028 Zinc finger

IPR007087 515 535 PS00028 Zinc finger

IPR007087 543 563 PS00028 Zinc finger

IPR007087 571 591 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	9	32	PD000003	Zinc finger
IPR007087	37	60	PD000003	Zinc finger
IPR007087	65	87	PD000003	Zinc finger
IPR007087	121	144	PD000003	Zinc finger
IPR007087	149	172	PD000003	Zinc finger
IPR007087	177	200	PD000003	Zinc finger
IPR007087	205	228	PD000003	Zinc finger
IPR007087	233	256	PD000003	Zinc finger
IPR007087	261	284	PD000003	Zinc finger
IPR007087	289	312	PD000003	Zinc finger
IPR007087	317	340	PD000003	Zinc finger
IPR007087	345	368	PD000003	Zinc finger
IPR007087	373	396	PD000003	Zinc finger
IPR007087	401	424	PD000003	Zinc finger
IPR007087	429	452	PD000003	Zinc finger
IPR007087	457	480	PD000003	Zinc finger
IPR007087	485	508	PD000003	Zinc finger
IPR007087	513	536	PD000003	Zinc finger
IPR007087	541	564	PD000003	Zinc finger
IPR007087	569	592	PD000003	Zinc finger
HMMPfam	IPR007087	9	31	PF00096	Zinc finger
IPR007087	37	59	PF00096	Zinc finger
IPR007087	65	87	PF00096	Zinc finger
IPR007087	121	143	PF00096	Zinc finger
IPR007087	149	171	PF00096	Zinc finger
IPR007087	177	199	PF00096	Zinc finger
IPR007087	205	227	PF00096	Zinc finger
IPR007087	233	255	PF00096	Zinc finger
IPR007087	261	283	PF00096	Zinc finger
IPR007087	345	367	PF00096	Zinc finger
IPR007087	373	395	PF00096	Zinc finger
IPR007087	429	451	PF00096	Zinc finger
IPR007087	457	479	PF00096	Zinc finger
IPR007087	485	507	PF00096	Zinc finger
IPR007087	513	535	PF00096	Zinc finger
IPR007087	541	563	PF00096	Zinc finger
IPR007087	569	591	PF00096	Zinc finger
HMMSmart	IPR015880	9	31	SM00355	Zinc finger
IPR015880	37	59	SM00355	Zinc finger
IPR015880	65	87	SM00355	Zinc finger
IPR015880	121	143	SM00355	Zinc finger
IPR015880	149	171	SM00355	Zinc finger
IPR015880	177	199	SM00355	Zinc finger
IPR015880	205	227	SM00355	Zinc finger
IPR015880	233	255	SM00355	Zinc finger
IPR015880	261	283	SM00355	Zinc finger
IPR015880	317	337	SM00355	Zinc finger
IPR015880	345	367	SM00355	Zinc finger
IPR015880	373	395	SM00355	Zinc finger
IPR015880	429	451	SM00355	Zinc finger
IPR015880	457	479	SM00355	Zinc finger
IPR015880	485	507	SM00355	Zinc finger
IPR015880	513	535	SM00355	Zinc finger
IPR015880	541	563	SM00355	Zinc finger
IPR015880	569	591	SM00355	Zinc finger
ProfileScan	IPR007087	9	36	PS50157	Zinc finger
IPR007087	37	64	PS50157	Zinc finger
IPR007087	65	92	PS50157	Zinc finger
IPR007087	93	120	PS50157	Zinc finger
IPR007087	121	148	PS50157	Zinc finger
IPR007087	149	176	PS50157	Zinc finger
IPR007087	177	204	PS50157	Zinc finger
IPR007087	205	232	PS50157	Zinc finger
IPR007087	233	260	PS50157	Zinc finger
IPR007087	261	288	PS50157	Zinc finger
IPR007087	289	316	PS50157	Zinc finger
IPR007087	317	344	PS50157	Zinc finger
IPR007087	345	372	PS50157	Zinc finger
IPR007087	373	400	PS50157	Zinc finger
IPR007087	401	428	PS50157	Zinc finger
IPR007087	429	456	PS50157	Zinc finger
IPR007087	457	484	PS50157	Zinc finger
IPR007087	485	512	PS50157	Zinc finger
IPR007087	513	540	PS50157	Zinc finger
IPR007087	541	568	PS50157	Zinc finger
IPR007087	569	596	PS50157	Zinc finger
ScanRegExp	IPR007087	11	31	PS00028	Zinc finger
IPR007087	39	59	PS00028	Zinc finger
IPR007087	67	87	PS00028	Zinc finger
IPR007087	123	143	PS00028	Zinc finger
IPR007087	151	171	PS00028	Zinc finger
IPR007087	179	199	PS00028	Zinc finger
IPR007087	207	227	PS00028	Zinc finger
IPR007087	235	255	PS00028	Zinc finger
IPR007087	263	283	PS00028	Zinc finger
IPR007087	347	367	PS00028	Zinc finger
IPR007087	375	395	PS00028	Zinc finger
IPR007087	431	451	PS00028	Zinc finger
IPR007087	459	479	PS00028	Zinc finger
IPR007087	487	507	PS00028	Zinc finger
IPR007087	515	535	PS00028	Zinc finger
IPR007087	543	563	PS00028	Zinc finger
IPR007087	571	591	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGGCCAGTAAAGCTAAAGTCC

Primer_r
: AGGCTGTTGTCTTTGGGAATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	1700 bp
Genome contig ID	gi89161207r_323781
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AACTTAATTTTTGAAATAAAAATTGTTATTGTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATTTTTGTGCCGTGAATGAAGTGTTTTATTATGCCACCAACTTTCAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	r	423781	427284	1	99.0	Perfect prediction

Primer_f	: AGGCCAGTAAAGCTAAAGTCC
Primer_r	: AGGCTGTTGTCTTTGGGAATG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1982

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information