HUGE

Gene/Protein Characteristic Table for KIAA1871

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07499
Accession No. :	AB058774
Description :	zinc finger protein 594.
HUGO Gene Name :	zinc finger protein 594 (ZNF594)
Clone Name :	hj05256s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hj05256, former representative clones for KIAA1871 with hj05256s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4862 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2297 bp

Genome contig ID gi51511734r_4923555
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TAACTGAATGTTGAAATAAAAGTTATTTAAGAATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTTAGTGACTGTTTAGTATGTGCCAGGGGCCGTAATTAGATGGGGCTGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 5023555 5028416 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 821 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96JF6	0	100.0	Zinc finger pro...	Homo sapiens
XP_523843	0	98.5	zinc finger pro...	Pan troglodytes
EAW90352	0	97.9	hCG1775942, iso...	Homo sapiens
XP_001918156	7.2e-209	61.0	similar to hCG1...	Equus caballus
XP_001099720	7.2e-209	86.8	similar to zinc...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046831	4.9e-88	51.4	KIAA1611
AB075862	3.8e-85	50.9	KIAA1982
AB037770	3.3e-73	46.4	KIAA1349
AB075836	2.6e-69	43.2	KIAA1956
AB075827	3.6e-68	44.8	KIAA1947

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 141 164 PD000003 Zinc finger

IPR007087 169 192 PD000003 Zinc finger

IPR007087 197 220 PD000003 Zinc finger

IPR007087 225 248 PD000003 Zinc finger

IPR007087 253 276 PD000003 Zinc finger

IPR007087 281 304 PD000003 Zinc finger

IPR007087 310 332 PD000003 Zinc finger

IPR007087 418 441 PD000003 Zinc finger

IPR007087 447 469 PD000003 Zinc finger

IPR007087 474 497 PD000003 Zinc finger

IPR007087 502 525 PD000003 Zinc finger

IPR007087 530 552 PD000003 Zinc finger

IPR007087 610 633 PD000003 Zinc finger

IPR007087 638 661 PD000003 Zinc finger

IPR007087 666 689 PD000003 Zinc finger

IPR007087 694 717 PD000003 Zinc finger

IPR007087 722 744 PD000003 Zinc finger

HMMPfam IPR007087 141 163 PF00096 Zinc finger

IPR007087 169 191 PF00096 Zinc finger

IPR007087 197 219 PF00096 Zinc finger

IPR007087 225 247 PF00096 Zinc finger

IPR007087 253 275 PF00096 Zinc finger

IPR007087 281 303 PF00096 Zinc finger

IPR007087 309 331 PF00096 Zinc finger

IPR007087 337 359 PF00096 Zinc finger

IPR007087 390 412 PF00096 Zinc finger

IPR007087 418 440 PF00096 Zinc finger

IPR007087 446 468 PF00096 Zinc finger

IPR007087 474 496 PF00096 Zinc finger

IPR007087 502 524 PF00096 Zinc finger

IPR007087 530 552 PF00096 Zinc finger

IPR007087 582 604 PF00096 Zinc finger

IPR007087 610 632 PF00096 Zinc finger

IPR007087 638 660 PF00096 Zinc finger

IPR007087 666 688 PF00096 Zinc finger

IPR007087 694 716 PF00096 Zinc finger

IPR007087 722 744 PF00096 Zinc finger

IPR007087 775 797 PF00096 Zinc finger

HMMSmart IPR015880 113 135 SM00355 Zinc finger

IPR015880 141 163 SM00355 Zinc finger

IPR015880 169 191 SM00355 Zinc finger

IPR015880 197 219 SM00355 Zinc finger

IPR015880 225 247 SM00355 Zinc finger

IPR015880 253 275 SM00355 Zinc finger

IPR015880 281 303 SM00355 Zinc finger

IPR015880 309 331 SM00355 Zinc finger

IPR015880 337 359 SM00355 Zinc finger

IPR015880 390 412 SM00355 Zinc finger

IPR015880 418 440 SM00355 Zinc finger

IPR015880 446 468 SM00355 Zinc finger

IPR015880 474 496 SM00355 Zinc finger

IPR015880 502 524 SM00355 Zinc finger

IPR015880 530 552 SM00355 Zinc finger

IPR015880 582 604 SM00355 Zinc finger

IPR015880 610 632 SM00355 Zinc finger

IPR015880 638 660 SM00355 Zinc finger

IPR015880 666 688 SM00355 Zinc finger

IPR015880 694 716 SM00355 Zinc finger

IPR015880 722 744 SM00355 Zinc finger

IPR015880 775 797 SM00355 Zinc finger

ProfileScan IPR007087 141 168 PS50157 Zinc finger

IPR007087 169 196 PS50157 Zinc finger

IPR007087 197 224 PS50157 Zinc finger

IPR007087 225 252 PS50157 Zinc finger

IPR007087 253 280 PS50157 Zinc finger

IPR007087 281 308 PS50157 Zinc finger

IPR007087 309 336 PS50157 Zinc finger

IPR007087 337 364 PS50157 Zinc finger

IPR007087 362 389 PS50157 Zinc finger

IPR007087 390 417 PS50157 Zinc finger

IPR007087 418 445 PS50157 Zinc finger

IPR007087 446 473 PS50157 Zinc finger

IPR007087 474 501 PS50157 Zinc finger

IPR007087 502 529 PS50157 Zinc finger

IPR007087 530 557 PS50157 Zinc finger

IPR007087 582 609 PS50157 Zinc finger

IPR007087 610 637 PS50157 Zinc finger

IPR007087 638 665 PS50157 Zinc finger

IPR007087 666 693 PS50157 Zinc finger

IPR007087 694 721 PS50157 Zinc finger

IPR007087 722 749 PS50157 Zinc finger

IPR007087 775 802 PS50157 Zinc finger

ScanRegExp IPR007087 143 163 PS00028 Zinc finger

IPR007087 199 219 PS00028 Zinc finger

IPR007087 227 247 PS00028 Zinc finger

IPR007087 255 275 PS00028 Zinc finger

IPR007087 283 303 PS00028 Zinc finger

IPR007087 311 331 PS00028 Zinc finger

IPR007087 339 359 PS00028 Zinc finger

IPR007087 392 412 PS00028 Zinc finger

IPR007087 420 440 PS00028 Zinc finger

IPR007087 446 468 PS00028 Zinc finger

IPR007087 476 496 PS00028 Zinc finger

IPR007087 504 524 PS00028 Zinc finger

IPR007087 532 552 PS00028 Zinc finger

IPR007087 584 604 PS00028 Zinc finger

IPR007087 612 632 PS00028 Zinc finger

IPR007087 640 660 PS00028 Zinc finger

IPR007087 668 688 PS00028 Zinc finger

IPR007087 696 716 PS00028 Zinc finger

IPR007087 724 744 PS00028 Zinc finger

IPR007087 777 797 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	141	164	PD000003	Zinc finger
IPR007087	169	192	PD000003	Zinc finger
IPR007087	197	220	PD000003	Zinc finger
IPR007087	225	248	PD000003	Zinc finger
IPR007087	253	276	PD000003	Zinc finger
IPR007087	281	304	PD000003	Zinc finger
IPR007087	310	332	PD000003	Zinc finger
IPR007087	418	441	PD000003	Zinc finger
IPR007087	447	469	PD000003	Zinc finger
IPR007087	474	497	PD000003	Zinc finger
IPR007087	502	525	PD000003	Zinc finger
IPR007087	530	552	PD000003	Zinc finger
IPR007087	610	633	PD000003	Zinc finger
IPR007087	638	661	PD000003	Zinc finger
IPR007087	666	689	PD000003	Zinc finger
IPR007087	694	717	PD000003	Zinc finger
IPR007087	722	744	PD000003	Zinc finger
HMMPfam	IPR007087	141	163	PF00096	Zinc finger
IPR007087	169	191	PF00096	Zinc finger
IPR007087	197	219	PF00096	Zinc finger
IPR007087	225	247	PF00096	Zinc finger
IPR007087	253	275	PF00096	Zinc finger
IPR007087	281	303	PF00096	Zinc finger
IPR007087	309	331	PF00096	Zinc finger
IPR007087	337	359	PF00096	Zinc finger
IPR007087	390	412	PF00096	Zinc finger
IPR007087	418	440	PF00096	Zinc finger
IPR007087	446	468	PF00096	Zinc finger
IPR007087	474	496	PF00096	Zinc finger
IPR007087	502	524	PF00096	Zinc finger
IPR007087	530	552	PF00096	Zinc finger
IPR007087	582	604	PF00096	Zinc finger
IPR007087	610	632	PF00096	Zinc finger
IPR007087	638	660	PF00096	Zinc finger
IPR007087	666	688	PF00096	Zinc finger
IPR007087	694	716	PF00096	Zinc finger
IPR007087	722	744	PF00096	Zinc finger
IPR007087	775	797	PF00096	Zinc finger
HMMSmart	IPR015880	113	135	SM00355	Zinc finger
IPR015880	141	163	SM00355	Zinc finger
IPR015880	169	191	SM00355	Zinc finger
IPR015880	197	219	SM00355	Zinc finger
IPR015880	225	247	SM00355	Zinc finger
IPR015880	253	275	SM00355	Zinc finger
IPR015880	281	303	SM00355	Zinc finger
IPR015880	309	331	SM00355	Zinc finger
IPR015880	337	359	SM00355	Zinc finger
IPR015880	390	412	SM00355	Zinc finger
IPR015880	418	440	SM00355	Zinc finger
IPR015880	446	468	SM00355	Zinc finger
IPR015880	474	496	SM00355	Zinc finger
IPR015880	502	524	SM00355	Zinc finger
IPR015880	530	552	SM00355	Zinc finger
IPR015880	582	604	SM00355	Zinc finger
IPR015880	610	632	SM00355	Zinc finger
IPR015880	638	660	SM00355	Zinc finger
IPR015880	666	688	SM00355	Zinc finger
IPR015880	694	716	SM00355	Zinc finger
IPR015880	722	744	SM00355	Zinc finger
IPR015880	775	797	SM00355	Zinc finger
ProfileScan	IPR007087	141	168	PS50157	Zinc finger
IPR007087	169	196	PS50157	Zinc finger
IPR007087	197	224	PS50157	Zinc finger
IPR007087	225	252	PS50157	Zinc finger
IPR007087	253	280	PS50157	Zinc finger
IPR007087	281	308	PS50157	Zinc finger
IPR007087	309	336	PS50157	Zinc finger
IPR007087	337	364	PS50157	Zinc finger
IPR007087	362	389	PS50157	Zinc finger
IPR007087	390	417	PS50157	Zinc finger
IPR007087	418	445	PS50157	Zinc finger
IPR007087	446	473	PS50157	Zinc finger
IPR007087	474	501	PS50157	Zinc finger
IPR007087	502	529	PS50157	Zinc finger
IPR007087	530	557	PS50157	Zinc finger
IPR007087	582	609	PS50157	Zinc finger
IPR007087	610	637	PS50157	Zinc finger
IPR007087	638	665	PS50157	Zinc finger
IPR007087	666	693	PS50157	Zinc finger
IPR007087	694	721	PS50157	Zinc finger
IPR007087	722	749	PS50157	Zinc finger
IPR007087	775	802	PS50157	Zinc finger
ScanRegExp	IPR007087	143	163	PS00028	Zinc finger
IPR007087	199	219	PS00028	Zinc finger
IPR007087	227	247	PS00028	Zinc finger
IPR007087	255	275	PS00028	Zinc finger
IPR007087	283	303	PS00028	Zinc finger
IPR007087	311	331	PS00028	Zinc finger
IPR007087	339	359	PS00028	Zinc finger
IPR007087	392	412	PS00028	Zinc finger
IPR007087	420	440	PS00028	Zinc finger
IPR007087	446	468	PS00028	Zinc finger
IPR007087	476	496	PS00028	Zinc finger
IPR007087	504	524	PS00028	Zinc finger
IPR007087	532	552	PS00028	Zinc finger
IPR007087	584	604	PS00028	Zinc finger
IPR007087	612	632	PS00028	Zinc finger
IPR007087	640	660	PS00028	Zinc finger
IPR007087	668	688	PS00028	Zinc finger
IPR007087	696	716	PS00028	Zinc finger
IPR007087	724	744	PS00028	Zinc finger
IPR007087	777	797	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TACTCCCCTATGTCCTGTGTC

Primer_r
: TTGGGCTGGAATTTTAGTACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2297 bp
Genome contig ID	gi51511734r_4923555
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TAACTGAATGTTGAAATAAAAGTTATTTAAGAATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTAGTGACTGTTTAGTATGTGCCAGGGGCCGTAATTAGATGGGGCTGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	5023555	5028416	1	99.0	Perfect prediction

Primer_f	: TACTCCCCTATGTCCTGTGTC
Primer_r	: TTGGGCTGGAATTTTAGTACC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1871

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information