HUGE

Gene/Protein Characteristic Table for KIAA0427

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00535
Accession No. :	AB007887
Description :
HUGO Gene Name :
Clone Name :	hh01382 [Vector Info]
Flexi ORF Clone :	pF1KSDA0427
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5737 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 601 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL09491	1.4e-209	93.3	gene model 672,...	Mus musculus
XP_001086969	4.8e-208	94.1	hypothetical pr...	Macaca mulatta
XP_001087210	3e-207	93.8	hypothetical pr...	Macaca mulatta
BAG53180	2.1e-194	99.8	unnamed protein...	Homo sapiens
BAE90729	3.4e-186	99.0	unnamed protein...	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003890 379 580 PF02854 MIF4G-like

HMMSmart IPR003890 379 580 SM00543 MIF4G-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003890	379	580	PF02854	MIF4G-like
HMMSmart	IPR003890	379	580	SM00543	MIF4G-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GGAAAGCAGGACATACCGACG

Primer_r
: GCCTTTGAGGACACAGATCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 18

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGAAAGCAGGACATACCGACG
Primer_r	: GCCTTTGAGGACACAGATCAG
PCR product length	: 89 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0427

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information