HUGE

Gene/Protein Characteristic Table for KIAA0430

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05840
Accession No. :	AB007890
Description :	Limkain-b1.
HUGO Gene Name :
Clone Name :	hg02974 [Vector Info]
Source :	Human adult brain
Note :	We replaced hh01734, former representative clones for KIAA0430 with hg02974. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 6827 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2305 bp

Genome contig ID gi51511732r_15495746
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
AAACAGTTGTCAATAAACTTTACAAGCGAGCATCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTTGAGTTTCCCAAGTGAGTGGTTTTGTCTGTCTGTCTGTCTGTGGGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 r 15595746 15637137 25 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1506 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_511188	99.9	limkain b1 isof...	Pan troglodytes
XP_001149081	99.9	limkain b1 isof...	Pan troglodytes
Q9Y4F3	99.9	Limkain-b1.	Homo sapiens
XP_001108854	98.6	similar to limk...	Macaca mulatta
XP_001108939	98.6	similar to limk...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007491 115 259 PF04396 Protein of unknown function DUF537

HMMSmart IPR000504 277 345 SM00360 RNA recognition motif

IPR000504 556 630 SM00360 RNA recognition motif

ProfileScan IPR000504 555 634 PS50102 RNA recognition motif

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007491	115	259	PF04396	Protein of unknown function DUF537
HMMSmart	IPR000504	277	345	SM00360	RNA recognition motif
IPR000504	556	630	SM00360	RNA recognition motif
ProfileScan	IPR000504	555	634	PS50102	RNA recognition motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TCCCAACACACAAAACAGCAC

Primer_r
: CACTGTTTGTTTTGGATTGGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCCCAACACACAAAACAGCAC
Primer_r	: CACTGTTTGTTTTGGATTGGG
PCR product length	: 106 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2305 bp
Genome contig ID	gi51511732r_15495746
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- AAACAGTTGTCAATAAACTTTACAAGCGAGCATCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTTGAGTTTCCCAAGTGAGTGGTTTTGTCTGTCTGTCTGTCTGTGGGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	r	15595746	15637137	25	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0430

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information