HUGE

Gene/Protein Characteristic Table for KIAA0435

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06297
Accession No. :	AB007895
Description :	pecanex-like 2.
HUGO Gene Name :	pecanex-like 2 (Drosophila) (PCNXL2)
Clone Name :	hh02241 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5347 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1818 bp

Genome contig ID gi89161185r_231086505
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTGTTCCAGAACACAGAACTGATCTCAGGTTTTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAAAAATCAAACAACAACAACAAAAAAAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 231186505 231260887 10 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 787 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI22241	99.9	pecanex-like 2 ...	Homo sapiens
EAW69986	99.7	pecanex-like 2 ...	Homo sapiens
BAB84904	98.5	FLJ00149 protei...	Homo sapiens
XP_001103656	98.2	similar to peca...	Macaca mulatta
BAG51507	99.7	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018348	6.4e-98	53.0	KIAA0805

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007735 275 507 PF05041 Pecanex

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007735	275	507	PF05041	Pecanex

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCTCGCAGCAAAGTGTGTCAG

Primer_r
: CGGTATTGGTTGGTTGTGGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCTCGCAGCAAAGTGTGTCAG
Primer_r	: CGGTATTGGTTGGTTGTGGTG
PCR product length	: 129 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1818 bp
Genome contig ID	gi89161185r_231086505
PolyA signal sequence (None)	+--------+--------+----*----+---- CTGTTCCAGAACACAGAACTGATCTCAGGTTTTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAAATCAAACAACAACAACAAAAAAAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	231186505	231260887	10	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0435

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information