| HUGE |
Gene/Protein Characteristic Table for KIAA0443 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00078 |
|---|---|
| Accession No. : | AB007903 |
| Description : | G-protein coupled receptor-associated sorting protein 1. |
| HUGO Gene Name : | |
| Clone Name : | pj00552 [Vector Info] |
| Flexi ORF Clone : | pF1KA0443
|
| Source : | Human brain (hippocampus) |
| Note : | We replaced hj00137, former representative clones for KIAA0443 with pj00552. (2004/1/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4705 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 351 bp Genome contig ID gi89161218f_101695332 PolyA signal sequence
(AATAAA,-25)
TTTGTGTTTCAATAAAGTCCTATGTTAAAGTTGGCFlanking genome sequence
(104706 - 104755)
AGAAATCACCCTTCTTCTTGAAATTAAAATACAGACCCAATGATAACACA
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1404 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : AACGACAATCAGAAGGGTGGC | |
| : GATGCCAGCTGAATATTAGAG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 9 |
| : GeneBridge 4 | |
| : AACGACAATCAGAAGGGTGGC | |
| : GATGCCAGCTGAATATTAGAG | |
| : 128 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
