| HUGE |
Gene/Protein Characteristic Table for KIAA0457 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Mapping | |
| Product ID : | ORK00541 |
|---|---|
| Accession No. : | AB007926 |
| Description : | Disrupted in schizophrenia 1 protein. |
| HUGO Gene Name : | |
| Clone Name : | hg00693 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0457
|
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6833 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4295 bp Genome contig ID gi89161185f_229729198 PolyA signal sequence
(AATAAA,-22)
TTTTGTTATACAAAATAAAAGCTGATATCCAAGGCFlanking genome sequence
(514299 - 514348)
ATGGTGCATCTTGATGATTTTTTGTCCTTTGAAGTATGGATGATAGAAAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 229829198 230243495 13 99.8 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 845 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
| Motif_DB | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| None | - | - | - | - | - |
| Method | No. | N terminal | transmembrane region | C terminal | type | length |
|---|---|---|---|---|---|---|
| - | - | - | - | - | - | - |
RH mapping information |
Description | |
|---|---|---|
| : 1 |
| : GeneBridge 4 | |
| : CAAGAAAGTCAGCCCAGTGTC | |
| : TCAGACAGGCATCAACAAACC | |
| : 108 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
