HUGE |
Gene/Protein Characteristic Table for KIAA0464 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | |
---|---|
Accession No. : | AB007933 |
Description : | Carboxyl-terminal PDZ ligand of neuronal nitric oxide synthase protein. |
HUGO Gene Name : | nitric oxide synthase 1 (neuronal) adaptor protein (NOS1AP) |
Clone Name : | hg01093 [Vector Info] |
Flexi ORF Clone : | pF1KA0464
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6667 bp
![]() |
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
cloned DNA seq. | Warning for N-terminal truncation: NO | NO | Warning for coding interruption: YES | NO | |
Length of 3'UTR 971 bp Genome contig ID gi89161185f_160206205 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CCCTCCACTGGGCAGTGGTGGTCAGTTTTTACTGCFlanking genome sequence
(398649 - 398698) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAGAAAAAAGAGAAAGAAAAAAAAGAATGAATGCAAGCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 160306205 160604852 10 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 586 aa
This protein sequence is predicted from the revised DNA sequence
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: CTAAGTGATTTGGAGCAGCAG | |
: TGTAGGGTGAGCATGGAATTG | |
: 188 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |