HUGE

Gene/Protein Characteristic Table for KIAA0467

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK05605
Accession No. :	AB007936
Description :
HUGO Gene Name :
Clone Name :	ff08895 [Vector Info]
Source :	Human fetal brain
Note :	We replaced hg01512, former representative clones for KIAA0467 with ff08895. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 10217 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2153 bp

Genome contig ID gi89161185f_43561384
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTAAATTCTCACCTTTAAAAATTGTCCTGACCTTT
Flanking genome sequence
(129509 - 129558)
----+----*----+----*----+----*----+----*----+----*
GCTTGCCCTTCTCAGGTATTCCATGCTGCTGTCTCTACTTCCTCTCCTCG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 43661384 43690891 57 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 2687 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX07098	98.5	hCG2036582, iso...	Homo sapiens
EAX07096	97.7	hCG2036582, iso...	Homo sapiens
EAX07097	97.6	hCG2036582, iso...	Homo sapiens
XP_613325	90.0	similar to hCG2...	Bos taurus
XP_001477707	89.2	hypothetical pr...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTTCTCTGCTGCTTCCCTCCC
Primer_r	: GGACATCACTGCTGGACATTC
PCR product length	: 204 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2153 bp
Genome contig ID	gi89161185f_43561384
PolyA signal sequence (None)	+--------+--------+----*----+---- CTAAATTCTCACCTTTAAAAATTGTCCTGACCTTT
Flanking genome sequence (129509 - 129558)	----+--------+--------+--------+--------+----* GCTTGCCCTTCTCAGGTATTCCATGCTGCTGTCTCTACTTCCTCTCCTCG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	43661384	43690891	57	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0467

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information