HUGE |
Gene/Protein Characteristic Table for KIAA0478 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK00546 |
---|---|
Accession No. : | AB007947 |
Description : | Zinc finger and BTB domain-containing protein 40. |
HUGO Gene Name : | zinc finger and BTB domain containing 40 (ZBTB40) |
Clone Name : | hh05955 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0478
![]() |
Source : | Human adult brain |
Note : | We replaced hh00573, former representative clones for KIAA0478 with hh05955. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6028 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2091 bp Genome contig ID gi89161185f_22550953 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
AAAACTCTTCGGAATAAAGAGGGCTGTAAATTTTGFlanking genome sequence
(176616 - 176665) ----+----*----+----*----+----*----+----*----+----*
AATTCCAGTGTCAGATCCTTTCAAGCACTGAGAAATTCTTTCTCAGGTTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 22650947 22727567 18 99.4 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 1253 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: GCAAGCTGAACAAGAATATGG | |
: TGGGGACTACATTGCTGAAGG | |
: 186 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |