HUGE

Gene/Protein Characteristic Table for KIAA1874

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00939
Accession No. :	AB058777
Description :	Zinc finger protein 286.
HUGO Gene Name :	zinc finger protein 286A (ZNF286A)
Clone Name :	hk07257s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA1874
Source :	Human adult brain
Note :	We replaced hk07257, former representative clones for KIAA1874 with hk07257s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4262 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2377 bp

Genome contig ID gi51511734f_15443780
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
GGTGTAAATATGTTGGTAATAAAATCTCCAACCAC
Flanking genome sequence
(145039 - 145088)
----+----*----+----*----+----*----+----*----+----*
AGCATAGTCATGGGAATGTTTTTGTTACAATTTTTGTTCTCAAGGTTATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 15543780 15588817 17 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 579 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG10170	8.7e-213	100.0	zinc finger pro...	synthetic construct
Q9HBT8	2.7e-212	99.8	Zinc finger pro...	Homo sapiens
BAG37536	4.8e-212	99.6	unnamed protein...	Homo sapiens
XP_001169558	3.4e-211	99.2	zinc finger pro...	Pan troglodytes
XP_001085916	4e-208	97.7	similar to zinc...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D31763	1.4e-55	52.2	KIAA0065
AB058732	6.1e-55	43.9	KIAA1829
AB058755	1.5e-54	38.2	KIAA1852
AB014528	7.3e-54	54.5	KIAA0628
AB046831	1e-53	44.5	KIAA1611

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 301 324 PD000003 Zinc finger

IPR007087 329 352 PD000003 Zinc finger

IPR007087 356 378 PD000003 Zinc finger

IPR007087 384 407 PD000003 Zinc finger

IPR007087 412 435 PD000003 Zinc finger

IPR007087 440 463 PD000003 Zinc finger

IPR007087 468 491 PD000003 Zinc finger

IPR007087 496 518 PD000003 Zinc finger

IPR007087 524 547 PD000003 Zinc finger

IPR007087 552 575 PD000003 Zinc finger

HMMPfam IPR001909 103 139 PF01352 KRAB box

IPR007087 301 323 PF00096 Zinc finger

IPR007087 329 351 PF00096 Zinc finger

IPR007087 356 378 PF00096 Zinc finger

IPR007087 384 406 PF00096 Zinc finger

IPR007087 412 434 PF00096 Zinc finger

IPR007087 440 462 PF00096 Zinc finger

IPR007087 468 490 PF00096 Zinc finger

IPR007087 496 518 PF00096 Zinc finger

IPR007087 524 546 PF00096 Zinc finger

IPR007087 552 574 PF00096 Zinc finger

HMMSmart IPR001909 103 158 SM00349 KRAB box

IPR015880 301 323 SM00355 Zinc finger

IPR015880 329 351 SM00355 Zinc finger

IPR015880 356 378 SM00355 Zinc finger

IPR015880 384 406 SM00355 Zinc finger

IPR015880 412 434 SM00355 Zinc finger

IPR015880 440 462 SM00355 Zinc finger

IPR015880 468 490 SM00355 Zinc finger

IPR015880 496 518 SM00355 Zinc finger

IPR015880 524 546 SM00355 Zinc finger

IPR015880 552 574 SM00355 Zinc finger

ProfileScan IPR001909 103 169 PS50805 KRAB box

IPR007087 301 328 PS50157 Zinc finger

IPR007087 329 352 PS50157 Zinc finger

IPR007087 356 383 PS50157 Zinc finger

IPR007087 384 411 PS50157 Zinc finger

IPR007087 412 439 PS50157 Zinc finger

IPR007087 440 467 PS50157 Zinc finger

IPR007087 468 495 PS50157 Zinc finger

IPR007087 496 523 PS50157 Zinc finger

IPR007087 524 551 PS50157 Zinc finger

IPR007087 552 579 PS50157 Zinc finger

ScanRegExp IPR007087 303 323 PS00028 Zinc finger

IPR007087 331 351 PS00028 Zinc finger

IPR007087 358 378 PS00028 Zinc finger

IPR007087 386 406 PS00028 Zinc finger

IPR007087 414 434 PS00028 Zinc finger

IPR007087 442 462 PS00028 Zinc finger

IPR007087 470 490 PS00028 Zinc finger

IPR007087 498 518 PS00028 Zinc finger

IPR007087 526 546 PS00028 Zinc finger

IPR007087 554 574 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	301	324	PD000003	Zinc finger
IPR007087	329	352	PD000003	Zinc finger
IPR007087	356	378	PD000003	Zinc finger
IPR007087	384	407	PD000003	Zinc finger
IPR007087	412	435	PD000003	Zinc finger
IPR007087	440	463	PD000003	Zinc finger
IPR007087	468	491	PD000003	Zinc finger
IPR007087	496	518	PD000003	Zinc finger
IPR007087	524	547	PD000003	Zinc finger
IPR007087	552	575	PD000003	Zinc finger
HMMPfam	IPR001909	103	139	PF01352	KRAB box
IPR007087	301	323	PF00096	Zinc finger
IPR007087	329	351	PF00096	Zinc finger
IPR007087	356	378	PF00096	Zinc finger
IPR007087	384	406	PF00096	Zinc finger
IPR007087	412	434	PF00096	Zinc finger
IPR007087	440	462	PF00096	Zinc finger
IPR007087	468	490	PF00096	Zinc finger
IPR007087	496	518	PF00096	Zinc finger
IPR007087	524	546	PF00096	Zinc finger
IPR007087	552	574	PF00096	Zinc finger
HMMSmart	IPR001909	103	158	SM00349	KRAB box
IPR015880	301	323	SM00355	Zinc finger
IPR015880	329	351	SM00355	Zinc finger
IPR015880	356	378	SM00355	Zinc finger
IPR015880	384	406	SM00355	Zinc finger
IPR015880	412	434	SM00355	Zinc finger
IPR015880	440	462	SM00355	Zinc finger
IPR015880	468	490	SM00355	Zinc finger
IPR015880	496	518	SM00355	Zinc finger
IPR015880	524	546	SM00355	Zinc finger
IPR015880	552	574	SM00355	Zinc finger
ProfileScan	IPR001909	103	169	PS50805	KRAB box
IPR007087	301	328	PS50157	Zinc finger
IPR007087	329	352	PS50157	Zinc finger
IPR007087	356	383	PS50157	Zinc finger
IPR007087	384	411	PS50157	Zinc finger
IPR007087	412	439	PS50157	Zinc finger
IPR007087	440	467	PS50157	Zinc finger
IPR007087	468	495	PS50157	Zinc finger
IPR007087	496	523	PS50157	Zinc finger
IPR007087	524	551	PS50157	Zinc finger
IPR007087	552	579	PS50157	Zinc finger
ScanRegExp	IPR007087	303	323	PS00028	Zinc finger
IPR007087	331	351	PS00028	Zinc finger
IPR007087	358	378	PS00028	Zinc finger
IPR007087	386	406	PS00028	Zinc finger
IPR007087	414	434	PS00028	Zinc finger
IPR007087	442	462	PS00028	Zinc finger
IPR007087	470	490	PS00028	Zinc finger
IPR007087	498	518	PS00028	Zinc finger
IPR007087	526	546	PS00028	Zinc finger
IPR007087	554	574	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAGCAGCAGGAATTATGTGAC

Primer_r
: TCTCGAGCCAGGCAGTATTTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCTCCGGTGTTTCCTTGATGG
Primer_r	: TGCACCATGGCTGTCAGTACC
PCR product length	: 95 bp
PCR conditions	: 15 °C66 sec60 °C30 sec99(500) cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2377 bp
Genome contig ID	gi51511734f_15443780
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GGTGTAAATATGTTGGTAATAAAATCTCCAACCAC
Flanking genome sequence (145039 - 145088)	----+--------+--------+--------+--------+----* AGCATAGTCATGGGAATGTTTTTGTTACAATTTTTGTTCTCAAGGTTATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	15543780	15588817	17	99.3	Perfect prediction

Primer_f	: AAGCAGCAGGAATTATGTGAC
Primer_r	: TCTCGAGCCAGGCAGTATTTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1874

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information