HUGE

Gene/Protein Characteristic Table for KIAA1829

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07488
Accession No. :	AB058732
Description :	Zinc finger protein 527.
HUGO Gene Name :	zinc finger protein 527 (ZNF527)
Clone Name :	hj00069 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4863 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3189 bp

Genome contig ID gi42406306f_42463015
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TGTGTATTTTATTTAAATTTTTTGTATTAAGTGCC
Flanking genome sequence
(112795 - 112844)
----+----*----+----*----+----*----+----*----+----*
TACTGTGTGCCAGGCTTTGTTCTAATCTAAGCAATGGAGATACAGCAGTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 42563015 42575808 2 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 557 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW56727	0	100.0	hCG1775038 [Hom...	Homo sapiens
BAG62727	0	99.6	unnamed protein...	Homo sapiens
Q8NB42	0	100.0	Zinc finger pro...	Homo sapiens
XP_001494212	0	89.6	zinc finger pro...	Equus caballus
AAI23538	1.1e-214	86.3	Zinc finger pro...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046831	5.4e-74	43.3	KIAA1611
AB058755	1.4e-71	40.3	KIAA1852
AB037770	2.7e-71	45.1	KIAA1349
AB075827	1.4e-69	54.3	KIAA1947
D31763	6.8e-69	45.5	KIAA0065

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 250 272 PD000003 Zinc finger

IPR007087 278 301 PD000003 Zinc finger

IPR007087 306 329 PD000003 Zinc finger

IPR007087 334 357 PD000003 Zinc finger

IPR007087 362 385 PD000003 Zinc finger

IPR007087 390 413 PD000003 Zinc finger

IPR007087 418 441 PD000003 Zinc finger

IPR007087 474 497 PD000003 Zinc finger

IPR007087 502 524 PD000003 Zinc finger

IPR007087 530 552 PD000003 Zinc finger

HMMPfam IPR007087 250 272 PF00096 Zinc finger

IPR007087 278 300 PF00096 Zinc finger

IPR007087 306 328 PF00096 Zinc finger

IPR007087 334 356 PF00096 Zinc finger

IPR007087 362 384 PF00096 Zinc finger

IPR007087 390 412 PF00096 Zinc finger

IPR007087 418 440 PF00096 Zinc finger

IPR007087 446 468 PF00096 Zinc finger

IPR007087 474 496 PF00096 Zinc finger

IPR007087 502 524 PF00096 Zinc finger

IPR007087 530 552 PF00096 Zinc finger

HMMSmart IPR015880 250 272 SM00355 Zinc finger

IPR015880 278 300 SM00355 Zinc finger

IPR015880 306 328 SM00355 Zinc finger

IPR015880 334 356 SM00355 Zinc finger

IPR015880 362 384 SM00355 Zinc finger

IPR015880 390 412 SM00355 Zinc finger

IPR015880 418 440 SM00355 Zinc finger

IPR015880 446 468 SM00355 Zinc finger

IPR015880 474 496 SM00355 Zinc finger

IPR015880 502 524 SM00355 Zinc finger

IPR015880 530 552 SM00355 Zinc finger

ProfileScan IPR001909 1 33 PS50805 KRAB box

IPR007087 222 249 PS50157 Zinc finger

IPR007087 250 277 PS50157 Zinc finger

IPR007087 278 305 PS50157 Zinc finger

IPR007087 306 333 PS50157 Zinc finger

IPR007087 334 361 PS50157 Zinc finger

IPR007087 362 389 PS50157 Zinc finger

IPR007087 390 417 PS50157 Zinc finger

IPR007087 418 445 PS50157 Zinc finger

IPR007087 446 473 PS50157 Zinc finger

IPR007087 474 501 PS50157 Zinc finger

IPR007087 502 529 PS50157 Zinc finger

IPR007087 530 557 PS50157 Zinc finger

ScanRegExp IPR007087 252 272 PS00028 Zinc finger

IPR007087 280 300 PS00028 Zinc finger

IPR007087 308 328 PS00028 Zinc finger

IPR007087 336 356 PS00028 Zinc finger

IPR007087 364 384 PS00028 Zinc finger

IPR007087 392 412 PS00028 Zinc finger

IPR007087 420 440 PS00028 Zinc finger

IPR007087 448 468 PS00028 Zinc finger

IPR007087 476 496 PS00028 Zinc finger

IPR007087 504 524 PS00028 Zinc finger

IPR007087 532 552 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	250	272	PD000003	Zinc finger
IPR007087	278	301	PD000003	Zinc finger
IPR007087	306	329	PD000003	Zinc finger
IPR007087	334	357	PD000003	Zinc finger
IPR007087	362	385	PD000003	Zinc finger
IPR007087	390	413	PD000003	Zinc finger
IPR007087	418	441	PD000003	Zinc finger
IPR007087	474	497	PD000003	Zinc finger
IPR007087	502	524	PD000003	Zinc finger
IPR007087	530	552	PD000003	Zinc finger
HMMPfam	IPR007087	250	272	PF00096	Zinc finger
IPR007087	278	300	PF00096	Zinc finger
IPR007087	306	328	PF00096	Zinc finger
IPR007087	334	356	PF00096	Zinc finger
IPR007087	362	384	PF00096	Zinc finger
IPR007087	390	412	PF00096	Zinc finger
IPR007087	418	440	PF00096	Zinc finger
IPR007087	446	468	PF00096	Zinc finger
IPR007087	474	496	PF00096	Zinc finger
IPR007087	502	524	PF00096	Zinc finger
IPR007087	530	552	PF00096	Zinc finger
HMMSmart	IPR015880	250	272	SM00355	Zinc finger
IPR015880	278	300	SM00355	Zinc finger
IPR015880	306	328	SM00355	Zinc finger
IPR015880	334	356	SM00355	Zinc finger
IPR015880	362	384	SM00355	Zinc finger
IPR015880	390	412	SM00355	Zinc finger
IPR015880	418	440	SM00355	Zinc finger
IPR015880	446	468	SM00355	Zinc finger
IPR015880	474	496	SM00355	Zinc finger
IPR015880	502	524	SM00355	Zinc finger
IPR015880	530	552	SM00355	Zinc finger
ProfileScan	IPR001909	1	33	PS50805	KRAB box
IPR007087	222	249	PS50157	Zinc finger
IPR007087	250	277	PS50157	Zinc finger
IPR007087	278	305	PS50157	Zinc finger
IPR007087	306	333	PS50157	Zinc finger
IPR007087	334	361	PS50157	Zinc finger
IPR007087	362	389	PS50157	Zinc finger
IPR007087	390	417	PS50157	Zinc finger
IPR007087	418	445	PS50157	Zinc finger
IPR007087	446	473	PS50157	Zinc finger
IPR007087	474	501	PS50157	Zinc finger
IPR007087	502	529	PS50157	Zinc finger
IPR007087	530	557	PS50157	Zinc finger
ScanRegExp	IPR007087	252	272	PS00028	Zinc finger
IPR007087	280	300	PS00028	Zinc finger
IPR007087	308	328	PS00028	Zinc finger
IPR007087	336	356	PS00028	Zinc finger
IPR007087	364	384	PS00028	Zinc finger
IPR007087	392	412	PS00028	Zinc finger
IPR007087	420	440	PS00028	Zinc finger
IPR007087	448	468	PS00028	Zinc finger
IPR007087	476	496	PS00028	Zinc finger
IPR007087	504	524	PS00028	Zinc finger
IPR007087	532	552	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
:

Primer_r
:

PCR conditions
: °C sec °C sec cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3189 bp
Genome contig ID	gi42406306f_42463015
PolyA signal sequence (None)	+--------+--------+----*----+---- TGTGTATTTTATTTAAATTTTTTGTATTAAGTGCC
Flanking genome sequence (112795 - 112844)	----+--------+--------+--------+--------+----* TACTGTGTGCCAGGCTTTGTTCTAATCTAAGCAATGGAGATACAGCAGTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	42563015	42575808	2	99.0	Perfect prediction

Primer_f	:
Primer_r	:
PCR conditions	: °C sec °C sec cycles

Gene/Protein Characteristic Table for KIAA1829

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information