HUGE

Gene/Protein Characteristic Table for KIAA0482

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00548
Accession No. :	AB088477
Description :	Period circadian protein homolog 1.
HUGO Gene Name :
Clone Name :	hj01880 [Vector Info]
Flexi ORF Clone :	pF1KSDA0482
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4649 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 596 bp

Genome contig ID gi51511734r_7884515
PolyA signal sequence
(GATAAA,-12)
+----*----+----*----+----*----+----
TTACTACTTTTTTAATACAAAAAGATAAAAACGCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CAGGACTTTGTGGAATGAAGTTTGGGGTTGGGGTGAGGGGAGCATGTCAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 7984515 7996420 23 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1332 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001118146	97.3	similar to peri...	Macaca mulatta
AAC51765	100.0	Rigui [Homo sap...	Homo sapiens
O15534	99.9	Period circadia...	Homo sapiens
BAF83750	99.8	unnamed protein...	Homo sapiens
XP_001167357	99.0	period 1 isofor...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002345	4.1e-39	44.4	KIAA0347
AB047686	4.1e-36	37.8	KIAA1779

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013655 412 507 PF08447 PAS fold-3

HMMSmart IPR000014 250 317 SM00091 PAS

IPR000014 390 456 SM00091 PAS

ProfileScan IPR000014 415 458 PS50112 PAS

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013655	412	507	PF08447	PAS fold-3
HMMSmart	IPR000014	250	317	SM00091	PAS
IPR000014	390	456	SM00091	PAS
ProfileScan	IPR000014	415	458	PS50112	PAS

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
:

Primer_r
:

PCR conditions
: °C sec °C sec cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GAACTCAGATGTGGCTAGACC
Primer_r	: TGTCAGCAACTTTGTCCAGGG
PCR product length	: 209 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	596 bp
Genome contig ID	gi51511734r_7884515
PolyA signal sequence (GATAAA,-12)	+--------+--------+----*----+---- TTACTACTTTTTTAATACAAAAAGATAAAAACGCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CAGGACTTTGTGGAATGAAGTTTGGGGTTGGGGTGAGGGGAGCATGTCAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	7984515	7996420	23	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0482

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information