HUGE

Gene/Protein Characteristic Table for KIAA1779

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK02054
Accession No. :	AB047686
Description :	Period circadian protein homolog 3.
HUGO Gene Name :
Clone Name :	hg04229 [Vector Info]
Flexi ORF Clone :	pF1KA1779
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6278 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2421 bp

Genome contig ID gi89161185f_7667301
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
AAAACAACAAATAAACTCTGTACATGTAAAACGTG
Flanking genome sequence
(160524 - 160573)
----+----*----+----*----+----*----+----*----+----*
AGAAATTGTCCTGCCCTGTGTCAACAAATCTTTGAATGTGTATTCTGTAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 7767301 7827823 21 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1233 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAB32925	100.0	period (Drosoph...	Homo sapiens
AAI46782	100.0	PER3 protein [H...	Homo sapiens
CAI21435	99.8	period homolog ...	Homo sapiens
P56645	99.2	Period circadia...	Homo sapiens
CAB76084	99.1	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB088477	1.9e-38	37.2	KIAA0482
AB002345	3.4e-33	37.4	KIAA0347

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013655 308 404 PF08447 PAS fold-3

HMMSmart IPR000014 139 211 SM00091 PAS

IPR000014 286 352 SM00091 PAS

ProfileScan IPR000014 308 354 PS50112 PAS

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013655	308	404	PF08447	PAS fold-3
HMMSmart	IPR000014	139	211	SM00091	PAS
IPR000014	286	352	SM00091	PAS
ProfileScan	IPR000014	308	354	PS50112	PAS

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGGGTCAGCAGCTCTACATTG

Primer_r
: CTCATCGTTCCTCAAATCCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2421 bp
Genome contig ID	gi89161185f_7667301
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- AAAACAACAAATAAACTCTGTACATGTAAAACGTG
Flanking genome sequence (160524 - 160573)	----+--------+--------+--------+--------+----* AGAAATTGTCCTGCCCTGTGTCAACAAATCTTTGAATGTGTATTCTGTAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	7767301	7827823	21	99.4	Perfect prediction

Primer_f	: TGGGTCAGCAGCTCTACATTG
Primer_r	: CTCATCGTTCCTCAAATCCTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1779

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information