HUGE

Gene/Protein Characteristic Table for KIAA0487

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK01669
Accession No. :	AB007956
Description :	Diphosphoinositol polyphosphate phosphohydrolase 2.
HUGO Gene Name :	nudix (nucleoside diphosphate linked moiety X)-type motif 4 (NUDT4)
Clone Name :	fk08362 [Vector Info]
Flexi ORF Clone :	pF1KA0487
Source :	Human fetal brain
Note :	We replaced hg00960, former representative clones for KIAA0487 with fk08362. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 3639 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2897 bp

Genome contig ID gi89161190f_92195865
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
ATATTTGGAAACATCAAATAAAAATGGAAAAAATG
Flanking genome sequence
(124319 - 124368)
----+----*----+----*----+----*----+----*----+----*
ATCATGGCTTTAAAAAAAAAACAAAAACACACACACATGAACTCAGATTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 92295865 92320182 6 99.1 Perfect prediction

ContigView(URL based/DAS) 1 r 143847481 143851271 3 99.0 Internal No-hit

Features of the protein sequence	Description

Length: 234 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001105592	1.3e-82	98.3	similar to nudi...	Macaca mulatta
XP_532650	7e-72	89.4	similar to nudi...	Canis lupus fam...
Q5RAF0	1.1e-61	100.0	Diphosphoinosit...	Pongo abelii
AAV38910	1.1e-61	100.0	nudix (nucleosi...	synthetic construct
BAE91688	1.3e-61	99.4	unnamed protein...	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000086 100 114 PR00502 NUDIX hydrolase

IPR000086 114 129 PR00502 NUDIX hydrolase

HMMPfam IPR000086 71 200 PF00293 NUDIX hydrolase

ScanRegExp IPR000086 105 126 PS00893 NUDIX hydrolase

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000086	100	114	PR00502	NUDIX hydrolase
IPR000086	114	129	PR00502	NUDIX hydrolase
HMMPfam	IPR000086	71	200	PF00293	NUDIX hydrolase
ScanRegExp	IPR000086	105	126	PS00893	NUDIX hydrolase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

Experimental conditions

Panel name	:
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2897 bp
Genome contig ID	gi89161190f_92195865
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- ATATTTGGAAACATCAAATAAAAATGGAAAAAATG
Flanking genome sequence (124319 - 124368)	----+--------+--------+--------+--------+----* ATCATGGCTTTAAAAAAAAAACAAAAACACACACACATGAACTCAGATTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	92295865	92320182	6	99.1	Perfect prediction
ContigView(URL based/DAS)	1	r	143847481	143851271	3	99.0	Internal No-hit

Gene/Protein Characteristic Table for KIAA0487

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information