HUGE

Gene/Protein Characteristic Table for KIAA0489

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK07636
Accession No. :	AB007958
Description :	Transmembrane protein 63A.
HUGO Gene Name :
Clone Name :	hg01128 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5406 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2553 bp

Genome contig ID gi89161185r_224014269
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTCTAGCCTGGGTGACTGAGCAAGACTCTGTCTCC
Flanking genome sequence
(99717 - 99668)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAACAGAAAAAGAAAAAATAAATGCCATGCTGGAGCCTTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 224113986 224120534 4 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 192 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O94886	6.5e-48	100.0	Transmembrane p...	Homo sapiens
BAG09849	6.5e-48	100.0	transmembrane p...	synthetic construct
BAG51078	1.5e-47	99.1	unnamed protein...	Homo sapiens
Q5R826	3.5e-47	98.2	Transmembrane p...	Pongo abelii
AAI51399	1.3e-43	80.3	TMEM63A protein...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018335	2.9e-45	100.0	KIAA0792

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003864 166 192 PF02714 Protein of unknown function DUF221

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003864	166	192	PF02714	Protein of unknown function DUF221

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTACAGCCTGGAAGAAGACGC
Primer_r	: AGCCTCTGGAAAGTAAACAAC
PCR product length	: 111 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2553 bp
Genome contig ID	gi89161185r_224014269
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCTAGCCTGGGTGACTGAGCAAGACTCTGTCTCC
Flanking genome sequence (99717 - 99668)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAACAGAAAAAGAAAAAATAAATGCCATGCTGGAGCCTTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	224113986	224120534	4	99.1	Perfect prediction

Gene/Protein Characteristic Table for KIAA0489

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information