HUGE |
Gene/Protein Characteristic Table for KIAA0489 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK07636 |
---|---|
Accession No. : | AB007958 |
Description : | Transmembrane protein 63A. |
HUGO Gene Name : | |
Clone Name : | hg01128 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5406 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2553 bp Genome contig ID gi89161185r_224014269 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CTCTAGCCTGGGTGACTGAGCAAGACTCTGTCTCCFlanking genome sequence
(99717 - 99668) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAACAGAAAAAGAAAAAATAAATGCCATGCTGGAGCCTTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 224113986 224120534 4 99.1 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 192 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: GTACAGCCTGGAAGAAGACGC | |
: AGCCTCTGGAAAGTAAACAAC | |
: 111 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |