HUGE |
Gene/Protein Characteristic Table for KIAA0493 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK07650 |
---|---|
Accession No. : | AB007962 |
Description : | |
HUGO Gene Name : | family with sequence similarity 91, member A2 (FAM91A2) |
Clone Name : | hh01176 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5734 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 2386 bp Genome contig ID gi89161185f_147743114 PolyA signal sequence
(AATAAA,-27) +----*----+----*----+----*----+----
CGTACACTAATAAAGAATTGAACATTTGTATTTGTFlanking genome sequence
(174619 - 174668) ----+----*----+----*----+----*----+----*----+----*
TGGCAGTGAGCCCAGTTGTTGGTGAATTTAAAGCTTAAAATATGGGAGTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 147843114 147917731 9 98.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 281 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: AACCGTTACTGCATTTACCTC | |
: CATGGCCTATGTATAGAATTG | |
: 87 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |