HUGE

Gene/Protein Characteristic Table for KIAA0493

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK07650
Accession No. :	AB007962
Description :
HUGO Gene Name :	family with sequence similarity 91, member A2 (FAM91A2)
Clone Name :	hh01176 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5734 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2386 bp

Genome contig ID gi89161185f_147743114
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
CGTACACTAATAAAGAATTGAACATTTGTATTTGT
Flanking genome sequence
(174619 - 174668)
----+----*----+----*----+----*----+----*----+----*
TGGCAGTGAGCCCAGTTGTTGGTGAATTTAAAGCTTAAAATATGGGAGTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 147843114 147917731 9 98.9 Perfect prediction

Features of the protein sequence	Description

Length: 281 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P0C866	3.1e-123	100.0	Putative protei...	Homo sapiens
XP_001165082	8.5e-118	97.2	hypothetical pr...	Pan troglodytes
EAW92049	7.8e-109	93.8	family with seq...	Homo sapiens
EAW92052	7.8e-109	93.8	family with seq...	Homo sapiens
EAW52038	3.7e-100	90.7	hCG1979841, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AACCGTTACTGCATTTACCTC
Primer_r	: CATGGCCTATGTATAGAATTG
PCR product length	: 87 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2386 bp
Genome contig ID	gi89161185f_147743114
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- CGTACACTAATAAAGAATTGAACATTTGTATTTGT
Flanking genome sequence (174619 - 174668)	----+--------+--------+--------+--------+----* TGGCAGTGAGCCCAGTTGTTGGTGAATTTAAAGCTTAAAATATGGGAGTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	147843114	147917731	9	98.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0493

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information