HUGE |
Gene/Protein Characteristic Table for KIAA0494 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK05606 |
---|---|
Accession No. : | AB007963 |
Description : | |
HUGO Gene Name : | |
Clone Name : | hh00201 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5766 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3301 bp Genome contig ID gi89161185r_46813420 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
AATTTAGCTAAATAAAAAAATTTCTTTTTTCTCTCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AATGTGTCTGACTAAAGCCTCTCTCACTCCCCTGCGATTTTTAAGGGAAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 46913420 46957323 11 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 536 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: ACCAACGCCAACAACAACGTG | |
: CAACTCTCGGCCACTCACACG | |
: 105 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |