HUGE

Gene/Protein Characteristic Table for KIAA0507

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK07644
Accession No. :	AB007976
Description :	RRP15-like protein.
HUGO Gene Name :
Clone Name :	hh00166 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5617 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5395 bp

Genome contig ID gi89161185f_216472330
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
GCCTTTTGATTAATAAAACTTTATTTTTAAGTGAG
Flanking genome sequence
(105618 - 105667)
----+----*----+----*----+----*----+----*----+----*
AACCTCTGTTTTCTTGATTTTTAAAAAAAGCCATTGCTATTTTGTTTTTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 216572330 216577946 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 73 aa
Result of homology search against nr database (FASTA output)
No significant homologues
Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CAAACAGGACTCTTCATACAG
Primer_r	: GAATCCAAACTCTACATACTG
PCR product length	: 80 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	5395 bp
Genome contig ID	gi89161185f_216472330
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GCCTTTTGATTAATAAAACTTTATTTTTAAGTGAG
Flanking genome sequence (105618 - 105667)	----+--------+--------+--------+--------+----* AACCTCTGTTTTCTTGATTTTTAAAAAAAGCCATTGCTATTTTGTTTTTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	216572330	216577946	1	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0507

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information