HUGE

Gene/Protein Characteristic Table for KIAA0508

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK07645
Accession No. :	AB007977
Description :
HUGO Gene Name :
Clone Name :	hh00207 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6013 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1647 bp

Genome contig ID gi89161185f_2095489
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTAGCCTGGCTGATATGGTGAAACCACGTATCTAC
Flanking genome sequence
(106016 - 106065)
----+----*----+----*----+----*----+----*----+----*
TAAAAAAAAAAAAATACAAAAATTAGCCGGCATTGTGGCAGGTGCCTGTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 2195489 2201503 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 253 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW56119	1e-05	48.3	hCG2033649 [Hom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCAGGTGGAAGGCAGACTCAG
Primer_r	: GTCAGGCAGTTTTAGAGTAGG
PCR product length	: 135 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1647 bp
Genome contig ID	gi89161185f_2095489
PolyA signal sequence (None)	+--------+--------+----*----+---- TTAGCCTGGCTGATATGGTGAAACCACGTATCTAC
Flanking genome sequence (106016 - 106065)	----+--------+--------+--------+--------+----* TAAAAAAAAAAAAATACAAAAATTAGCCGGCATTGTGGCAGGTGCCTGTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	2195489	2201503	1	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0508

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information