HUGE

Gene/Protein Characteristic Table for KIAA0515

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05607
Accession No. :	AB011087
Description :
HUGO Gene Name :
Clone Name :	hg00183 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6335 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Features of the protein sequence	Description

Length: 670 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_037450	1.4e-200	100.0	HLA-B associate...	Homo sapiens
EAW87971	1.4e-200	100.0	hCG30195, isofo...	Homo sapiens
XP_520327	2.4e-200	99.9	hypothetical pr...	Pan troglodytes
EAW87969	5.1e-200	99.9	hCG30195, isofo...	Homo sapiens
EAW87973	1.1e-199	99.9	hCG30195, isofo...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029019	2.3e-07	30.9	KIAA1096

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GTACTGAACCGGAGGGAAAGG

Primer_r
: ATGGCTAGAGGTGTAATGTGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTACTGAACCGGAGGGAAAGG
Primer_r	: ATGGCTAGAGGTGTAATGTGC
PCR product length	: 133 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Gene/Protein Characteristic Table for KIAA0515

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information