HUGE |
Gene/Protein Characteristic Table for KIAA0520 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01670 |
---|---|
Accession No. : | AB011092 |
Description : | Adenylate cyclase type 9. |
HUGO Gene Name : | |
Clone Name : | hg02989s1 [Vector Info] |
Flexi ORF Clone : | pF1KA0520 |
Source : | Human adult brain |
Note : | We replaced hg01313 and hg02989, former representative clones for KIAA0520 with hg02989s1. (2002/5/10,2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7544 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3102 bp Genome contig ID gi51511732r_3852654 PolyA signal sequence
(ATTAAA,-24) +----*----+----*----+----*----+----
AAGAAATGGACATTAAAATATTCTAAAATTTAAATFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATATGATGCCTGGTGTTTTCTTATTGAAAAGATGAGCACTGCTTCAGAGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 r 3952654 4106029 12 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1364 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: ACAGTCGGTTCTTGCTAATTC | |
: TGCTTCCTGTCACATGGGCTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 16 |
: GeneBridge 4 | |
: ACAGTCGGTTCTTGCTAATTC | |
: TGCTTCCTGTCACATGGGCTG | |
: 157 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |