HUGE |
Gene/Protein Characteristic Table for KIAA0542 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01089 |
---|---|
Accession No. : | AB011114 |
Description : | spindle assembly associated Sfi1 homolog isoform b. |
HUGO Gene Name : | Sfi1 homolog, spindle assembly associated (yeast) (SFI1) |
Clone Name : | hg04325s1 [Vector Info] |
Flexi ORF Clone : | pF1KA0542
![]() |
Source : | Human adult brain |
Note : | We replaced hg04325, former representative clones for KIAA0542 with hg04325s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4160 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 131 bp Genome contig ID gi89161203f_30122261 PolyA signal sequence
(ATTAAA,-21) +----*----+----*----+----*----+----
CAAAATGCTTTGCAATTAAATGAATTACTGTTCAGFlanking genome sequence
(222276 - 222325) ----+----*----+----*----+----*----+----*----+----*
AAGTCTCCCACTTTTCATACAAAAATACTGTGCTACTGATACAGTTGAAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 f 30222261 30344535 32 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1212 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CTGGGCCTGGACTTTCAACTG | |
: GAGGTTCTGCTTGGTGGTCTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 22 |
: GeneBridge 4 | |
: CTGGGCCTGGACTTTCAACTG | |
: GAGGTTCTGCTTGGTGGTCTG | |
: 101 (0.3k) bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |