HUGE |
Gene/Protein Characteristic Table for KIAA0546 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00095 |
---|---|
Accession No. : | AB011118 |
Description : | Coiled-coil domain-containing protein 131. |
HUGO Gene Name : | zinc finger, C3H1-type containing (ZFC3H1) |
Clone Name : | ef04555 [Vector Info] |
Flexi ORF Clone : | pF1KA0546
![]() |
Source : | |
Note : | We replaced hh00504, former representative clones for KIAA0546 with ef04555. (2003/4/2) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7597 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1655 bp Genome contig ID gi89161190r_70189745 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
AAGAAATTTTAATTTATAATAAAGTTTAACAGTTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAGAACAGTTAATATTTGAACTGCTTTGTATTGAAATACTACTTTGTAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 r 70289745 70343866 34 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1919 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: GATGGCTGTTCTCCTTGTTAG | |
: TCCTGTAGACTGTTCCTCATC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 12 |
: GeneBridge 4 | |
: GATGGCTGTTCTCCTTGTTAG | |
: TCCTGTAGACTGTTCCTCATC | |
: 154 (0.7k) bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |