HUGE

Gene/Protein Characteristic Table for KIAA0572

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05948
Accession No. :	AB011144
Description :	80 kDa MCM3-associated protein.
HUGO Gene Name :	minichromosome maintenance complex component 3 associated protein (MCM3AP)
Clone Name :	hh02391 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5755 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1872 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60318	100.0	80 kDa MCM3-ass...	Homo sapiens
AAI04959	100.0	Minichromosome ...	Homo sapiens
XP_525497	99.3	minichromosome ...	Pan troglodytes
XP_001488118	86.2	minichromosome ...	Equus caballus
BAH14134	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005062 576 802 PF03399 SAC3/GANP/Nin1/mts3/eIF-3 p25

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005062	576	802	PF03399	SAC3/GANP/Nin1/mts3/eIF-3 p25

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: ACATGATGAGGGAGCAACTGC

Primer_r
: ATTTCCAACAGTGCATCAAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 21

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACATGATGAGGGAGCAACTGC
Primer_r	: ATTTCCAACAGTGCATCAAGC
PCR product length	: 250 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0572

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information