HUGE

Gene/Protein Characteristic Table for KIAA0579

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07407
Accession No. :	AB011151
Description :	Zinc finger CCHC domain-containing protein 14.
HUGO Gene Name :
Clone Name :	bg00015 [Vector Info]
Flexi ORF Clone :	pF1KA0579
Source :	Human adult brain
Note :	We replaced hj00453, former representative clones for KIAA0579 with bg00015. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6769 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4034 bp

Genome contig ID gi51511732r_85897378
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TTAATGTACTGAAAATAAAAATTTTAAAAAAGAAC
Flanking genome sequence
(99977 - 99928)
----+----*----+----*----+----*----+----*----+----*
TGTTTTATTTCACTAGGTCTTTGTCTCAGAATATGAAGCACACACCTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 r 85997355 86082819 13 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 910 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8WYQ9	100.0	Zinc finger CCH...	Homo sapiens
BAF82371	99.9	unnamed protein...	Homo sapiens
AAI01479	99.9	Zinc finger, CC...	Homo sapiens
XP_001092159	99.2	similar to zinc...	Macaca mulatta
EAW95388	99.7	zinc finger, CC...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051531	5.8e-11	26.6	KIAA1744

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001878 867 876 PR00939 Zinc finger

IPR001878 876 884 PR00939 Zinc finger

HMMPfam IPR001660 255 316 PF00536 Sterile alpha motif SAM

IPR001878 867 884 PF00098 Zinc finger

HMMSmart IPR001878 868 884 SM00343 Zinc finger

ProfileScan IPR001878 869 884 PS50158 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001878	867	876	PR00939	Zinc finger
IPR001878	876	884	PR00939	Zinc finger
HMMPfam	IPR001660	255	316	PF00536	Sterile alpha motif SAM
IPR001878	867	884	PF00098	Zinc finger
HMMSmart	IPR001878	868	884	SM00343	Zinc finger
ProfileScan	IPR001878	869	884	PS50158	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: AAGGTTAACATTGCTCCACTG

Primer_r
: GTCCAATAGAAGCTGTGAAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAGGTTAACATTGCTCCACTG
Primer_r	: GTCCAATAGAAGCTGTGAAGG
PCR product length	: 179 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4034 bp
Genome contig ID	gi51511732r_85897378
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTAATGTACTGAAAATAAAAATTTTAAAAAAGAAC
Flanking genome sequence (99977 - 99928)	----+--------+--------+--------+--------+----* TGTTTTATTTCACTAGGTCTTTGTCTCAGAATATGAAGCACACACCTTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	r	85997355	86082819	13	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0579

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information