HUGE |
Gene/Protein Characteristic Table for KIAA1744 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07408 |
---|---|
Accession No. : | AB051531 |
Description : | Zinc finger CCHC domain-containing protein 2 (Fragment). |
HUGO Gene Name : | zinc finger, CCHC domain containing 2 (ZCCHC2) |
Clone Name : | pj01516 [Vector Info] |
Source : | Human brain (hippocampus) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4571 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2001 bp Genome contig ID gi51511735f_58257922 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
TGAATTAACAGCAATAAAAAAATGAAAAACAGCTTFlanking genome sequence
(138876 - 138925) ----+----*----+----*----+----*----+----*----+----*
AAGAATTGTGCCTCATTGTAAATTTTGTAAAAGTGGAGATAGGACATCAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 18 f 58357922 58396796 13 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 855 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ACTTTCTTTCAGGGGTGGGAG | |
: ACAACTCAACTGCAGCTTAAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 18 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |