HUGE

Gene/Protein Characteristic Table for KIAA1744

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07408
Accession No. :	AB051531
Description :	Zinc finger CCHC domain-containing protein 2 (Fragment).
HUGO Gene Name :	zinc finger, CCHC domain containing 2 (ZCCHC2)
Clone Name :	pj01516 [Vector Info]
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 4571 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2001 bp

Genome contig ID gi51511735f_58257922
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TGAATTAACAGCAATAAAAAAATGAAAAACAGCTT
Flanking genome sequence
(138876 - 138925)
----+----*----+----*----+----*----+----*----+----*
AAGAATTGTGCCTCATTGTAAATTTTGTAAAAGTGGAGATAGGACATCAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 18 f 58357922 58396796 13 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 855 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI37436	100.0	Zinc finger, CC...	Homo sapiens
EAW63126	100.0	zinc finger, CC...	Homo sapiens
Q9C0B9	100.0	Zinc finger CCH...	Homo sapiens
CAL38351	99.8	hypothetical pr...	synthetic construct
CAD38618	99.8	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011151	1e-09	26.3	KIAA0579

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001878 808 817 PR00939 Zinc finger

IPR001878 817 825 PR00939 Zinc finger

HMMPfam IPR001878 808 825 PF00098 Zinc finger

HMMSmart IPR001878 809 825 SM00343 Zinc finger

ProfileScan IPR001878 810 825 PS50158 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001878	808	817	PR00939	Zinc finger
IPR001878	817	825	PR00939	Zinc finger
HMMPfam	IPR001878	808	825	PF00098	Zinc finger
HMMSmart	IPR001878	809	825	SM00343	Zinc finger
ProfileScan	IPR001878	810	825	PS50158	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACTTTCTTTCAGGGGTGGGAG

Primer_r
: ACAACTCAACTGCAGCTTAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 18

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2001 bp
Genome contig ID	gi51511735f_58257922
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TGAATTAACAGCAATAAAAAAATGAAAAACAGCTT
Flanking genome sequence (138876 - 138925)	----+--------+--------+--------+--------+----* AAGAATTGTGCCTCATTGTAAATTTTGTAAAAGTGGAGATAGGACATCAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	18	f	58357922	58396796	13	99.2	Perfect prediction

Primer_f	: ACTTTCTTTCAGGGGTGGGAG
Primer_r	: ACAACTCAACTGCAGCTTAAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1744

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information