HUGE

Gene/Protein Characteristic Table for KIAA0587

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01597
Accession No. :	AB011159
Description :	Nck-associated protein 1.
HUGO Gene Name :
Clone Name :	hj02518 [Vector Info]
Flexi ORF Clone :	pF1KSDA0587
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4982 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1171 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001148485	99.9	NCK-associated ...	Pan troglodytes
XP_001099879	99.7	similar to NCK-...	Macaca mulatta
BAG09770	100.0	NCK-associated ...	synthetic construct
XP_001928596	99.8	NCK-associated ...	Sus scrofa
EAX10953	99.8	NCK-associated ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TGATCCTGCATTGGTCGTAGC

Primer_r
: AACTGCCACAAACACCATGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGATCCTGCATTGGTCGTAGC
Primer_r	: AACTGCCACAAACACCATGAG
PCR product length	: 103 (2.0k) bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0587

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information