HUGE |
Gene/Protein Characteristic Table for KIAA0594 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06903 |
---|---|
Accession No. : | AB011166 |
Description : | Structural maintenance of chromosomes protein 5. |
HUGO Gene Name : | structural maintenance of chromosomes 5 (SMC5) |
Clone Name : | hj02896s1 [Vector Info] |
Flexi ORF Clone : | pF1KA0594
![]() |
Source : | Human adult brain |
Note : | We replaced hj02896, former representative clones for KIAA0594 with hj02896s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5906 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2542 bp Genome contig ID gi89161216f_71963757 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
TGCTTTGTTGGTAATAAATCAATATTTTTATATTCFlanking genome sequence
(195854 - 195903) ----+----*----+----*----+----*----+----*----+----*
TTTTGGTGTATGTTATTTTAAGTGAGAACTATTTTTTATACTCTGAACCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 9 f 72063757 72159609 25 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1120 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: ATACCCGCAAAATGATAGAGG | |
: ACAATATGATCGTCCACACTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 9 |
: GeneBridge 4 | |
: AAGTCCTAGTTTCTCCCAATG | |
: CTGCTACCATTTTTGAACCCC | |
: 238 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |