Gene/Protein Characteristic Table for KIAA0803

Length: 5638 bp

Restriction map

The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.

Length of 3'UTR	511 bp
Genome contig ID	gi89161213f_91444103
PolyA signal sequence (AATAAA,-27)	+----*----+----*----+----*----+---- AGTACTGAAATAAAAATGACTTCACCATTTTCACC
Flanking genome sequence (133819 - 133868)	----+----*----+----*----+----*----+----*----+----* ACACTGTATTTGAACCTTCTTCATTTTTAACTGAGCCATAGTTCTTGGTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	91538244	91577920	23	99.9	Perfect prediction

Length: 1708 aa

This protein sequence is predicted from the revised DNA sequence

Entry Exp ID% Protein Source EAW76861 0 99.9 A kinase (PRKA)... Homo sapiens EAW76868 0 99.9 A kinase (PRKA)... Homo sapiens EAW76866 0 99.9 A kinase (PRKA)... Homo sapiens AAD22767 0 99.9 A-kinase anchor... Homo sapiens EAL24155 0 99.9 A kinase (PRKA)... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% HUGE_ID AB007862 2.4e-11 25.2 KIAA0402 AB011103 0.00063 21.4 KIAA0531 AB037755 0.00067 22.7 KIAA1334

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-