HUGE |
Gene/Protein Characteristic Table for KIAA0402 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06295 |
---|---|
Accession No. : | AB007862 |
Description : | Pericentrin. |
HUGO Gene Name : | pericentrin (PCNT) |
Clone Name : | hg01127s1 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced hg01127 and hf00540, former representative clones for KIAA0402 with hg01127s1. (2002/5/10,2003/8/28) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 10482 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 438 bp Genome contig ID gi51511750f_46469230 PolyA signal sequence
(AATAAA,-29) +----*----+----*----+----*----+----
AAAAGGAATAAAATTTAATCACTGTTTTGTTTGTGFlanking genome sequence
(220878 - 220927) ----+----*----+----*----+----*----+----*----+----*
AATAGCCCTTGTGTTGTTTTTTTTTTCCATTTTATCCATTTTATCAGTTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 21 f 46569230 46690106 47 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 3284 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: TGAAGTTTCCATCTGTACACG | |
: TGTGCTGTTGTGTCCTATCGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 21 |
: GeneBridge 4 | |
: TGAAGTTTCCATCTGTACACG | |
: TGTGCTGTTGTGTCCTATCGG | |
: 114 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |