HUGE

Gene/Protein Characteristic Table for KIAA0402

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06295
Accession No. :	AB007862
Description :	Pericentrin.
HUGO Gene Name :	pericentrin (PCNT)
Clone Name :	hg01127s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hg01127 and hf00540, former representative clones for KIAA0402 with hg01127s1. (2002/5/10,2003/8/28)

Features of the cloned DNA sequence	Description

Length: 10482 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 438 bp

Genome contig ID gi51511750f_46469230
PolyA signal sequence
(AATAAA,-29)
+----*----+----*----+----*----+----
AAAAGGAATAAAATTTAATCACTGTTTTGTTTGTG
Flanking genome sequence
(220878 - 220927)
----+----*----+----*----+----*----+----*----+----*
AATAGCCCTTGTGTTGTTTTTTTTTTCCATTTTATCCATTTTATCAGTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 21 f 46569230 46690106 47 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 3284 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX09279	100.0	pericentrin (ke...	Homo sapiens
O95613	97.2	Pericentrin; Pe...	Homo sapiens
AAP46636	97.2	pericentrin B [...	Homo sapiens
NP_006022	97.2	pericentrin [Ho...	Homo sapiens
EAX09277	99.2	pericentrin (ke...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018346	1.4e-10	25.2	KIAA0803
AB002334	1.6e-05	21.5	KIAA0336
D13629	0.00031	21.1	KIAA0004
AB002376	0.00046	22.3	KIAA0378
AB028975	0.00055	23.9	KIAA1052

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TGAAGTTTCCATCTGTACACG

Primer_r
: TGTGCTGTTGTGTCCTATCGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 21

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGAAGTTTCCATCTGTACACG
Primer_r	: TGTGCTGTTGTGTCCTATCGG
PCR product length	: 114 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	438 bp
Genome contig ID	gi51511750f_46469230
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- AAAAGGAATAAAATTTAATCACTGTTTTGTTTGTG
Flanking genome sequence (220878 - 220927)	----+--------+--------+--------+--------+----* AATAGCCCTTGTGTTGTTTTTTTTTTCCATTTTATCCATTTTATCAGTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	21	f	46569230	46690106	47	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0402

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information