HUGE

Gene/Protein Characteristic Table for KIAA0336

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00054
Accession No. :	AB002334
Description :	Ran-binding protein 2-like 4.
HUGO Gene Name :	GRIP and coiled-coil domain containing 2 (GCC2)
Clone Name :	hg01120 [Vector Info]
Flexi ORF Clone :	pF1KA0336
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6773 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1768 bp

Genome contig ID gi89161199f_108332128
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
TTATTTTAATATTTCTATTAAATATGTTTAACTGT
Flanking genome sequence
(160159 - 160208)
----+----*----+----*----+----*----+----*----+----*
ATATTTTTATGGCTGCTCTTTTATGTTACACACTGTCTCTTTGGGGTTGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 108432128 108492285 22 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1635 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_852118	100.0	GRIP and coiled...	Homo sapiens
EAW53882	100.0	GRIP and coiled...	Homo sapiens
Q8IWJ2	99.9	GRIP and coiled...	Homo sapiens
XP_001135112	98.4	GRIP and coiled...	Pan troglodytes
XP_001493196	86.1	GRIP and coiled...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020673	4.7e-09	23.6	KIAA0866
AB023217	2.5e-08	20.6	KIAA1000
AB029004	1.2e-05	22.1	KIAA1081
AB002371	1.5e-05	22.0	KIAA0373
AB007862	2.9e-05	21.7	KIAA0402

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000237 1563 1608 PF01465 GRIP

HMMSmart IPR000237 1563 1610 SM00755 GRIP

ProfileScan IPR000237 1560 1610 PS50913 GRIP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000237	1563	1608	PF01465	GRIP
HMMSmart	IPR000237	1563	1610	SM00755	GRIP
ProfileScan	IPR000237	1560	1610	PS50913	GRIP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CATTACACTTCCTCTCATTGC

Primer_r
: TAGTCTCTGCTTACGAATGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CATTACACTTCCTCTCATTGC
Primer_r	: TAGTCTCTGCTTACGAATGTC
PCR product length	: 112 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1768 bp
Genome contig ID	gi89161199f_108332128
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TTATTTTAATATTTCTATTAAATATGTTTAACTGT
Flanking genome sequence (160159 - 160208)	----+--------+--------+--------+--------+----* ATATTTTTATGGCTGCTCTTTTATGTTACACACTGTCTCTTTGGGGTTGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	108432128	108492285	22	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0336

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information