HUGE

Gene/Protein Characteristic Table for KIAA1000

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK02010
Accession No. :	AB023217
Description :	Myosin-15.
HUGO Gene Name :	myosin, heavy chain 15 (MYH15)
Clone Name :	hk09604y2 [Vector Info]
Flexi ORF Clone :	pF1KA1000
Source :	Human adult brain
Note :	We replaced hk09604y1 and hk09604, former representative clones for KIAA1000 with hk09604y2. (2008/2/6,2002/12/27)

Features of the cloned DNA sequence	Description

Length: 7074 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1176 bp

Genome contig ID gi89161205r_109482235
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
AAGGCTGAAGCTCTATAATAAATCTTTATTCTGTC
Flanking genome sequence
(99671 - 99622)
----+----*----+----*----+----*----+----*----+----*
ATTCTCTGATTCTGCCTCCCTGATCCAACCCTGACTCATATGGGTAGCTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 109581906 109730859 42 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1956 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y2K3	100.0	Myosin-15; Myos...	Homo sapiens
EAW79726	99.9	hCG1811516 [Hom...	Homo sapiens
XP_516637	99.0	myosin, heavy p...	Pan troglodytes
XP_001095819	96.4	similar to Myos...	Macaca mulatta
XP_848707	82.7	similar to myos...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040945	7.7e-160	60.6	KIAA1512
AB020673	1.8e-80	37.1	KIAA0866
AB111886	3e-47	33.1	KIAA2034
AB032945	9.9e-40	30.6	KIAA1119
AB018270	4.4e-30	33.3	KIAA0727

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001609 240 275 PD000355 Myosin head

FPrintScan IPR001609 143 162 PR00193 Myosin head

IPR001609 199 224 PR00193 Myosin head

IPR001609 248 275 PR00193 Myosin head

IPR001609 478 506 PR00193 Myosin head

IPR001609 532 560 PR00193 Myosin head

HMMPfam IPR004009 61 103 PF02736 Myosin

IPR001609 115 788 PF00063 Myosin head

IPR002928 1090 1948 PF01576 Myosin tail

HMMSmart IPR001609 107 801 SM00242 Myosin head

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001609	240	275	PD000355	Myosin head
FPrintScan	IPR001609	143	162	PR00193	Myosin head
IPR001609	199	224	PR00193	Myosin head
IPR001609	248	275	PR00193	Myosin head
IPR001609	478	506	PR00193	Myosin head
IPR001609	532	560	PR00193	Myosin head
HMMPfam	IPR004009	61	103	PF02736	Myosin
IPR001609	115	788	PF00063	Myosin head
IPR002928	1090	1948	PF01576	Myosin tail
HMMSmart	IPR001609	107	801	SM00242	Myosin head

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGGTTCTGTTTGTTCTTATGG
Primer_r	: GTGCTGGTGGAGAAGTCTAGG
PCR product length	: 123 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1176 bp
Genome contig ID	gi89161205r_109482235
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AAGGCTGAAGCTCTATAATAAATCTTTATTCTGTC
Flanking genome sequence (99671 - 99622)	----+--------+--------+--------+--------+----* ATTCTCTGATTCTGCCTCCCTGATCCAACCCTGACTCATATGGGTAGCTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	109581906	109730859	42	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA1000

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information