Gene/Protein Characteristic Table for KIAA2034

Length: 5472 bp

Restriction map

Length of 3'UTR	755 bp
Genome contig ID	gi42406306f_55344121
PolyA signal sequence (AATAAA,-27)	+----*----+----*----+----*----+---- CTGGCAGAAATAAACTCCAACCCGACTGGACCATC
Flanking genome sequence (161495 - 161544)	----+----*----+----*----+----*----+----*----+----* TCTGTGGCTGTGTGTGTTCCTGCAGGGGGTCTCTGATGGGGCAGGATGGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	55444121	55505614	31	99.8	Perfect prediction

Length: 1571 aa

Entry Exp ID% Protein Source BAG06723 0 100.0 MYH14 variant p... Homo sapiens ABR10605 0 91.1 nonmuscle myosi... Mus musculus NP_079005 0 97.9 myosin, heavy c... Homo sapiens NP_001070654 0 97.9 myosin, heavy c... Homo sapiens XP_524343 0 97.9 myosin, heavy p... Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% HUGE_ID AB020673 8.6e-124 59.8 KIAA0866 AB040945 1.6e-57 36.8 KIAA1512 AB023217 8.8e-50 33.1 KIAA1000 D86970 1.1e-19 26.8 KIAA0216 AB037740 5.6e-15 25.8 KIAA1319

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001609	16	44	PR00193	Myosin head
	IPR001609	70	98	PR00193	Myosin head
HMMPfam	IPR001609	3	364	PF00063	Myosin head
	IPR000048	380	400	PF00612	IQ calmodulin-binding region
	IPR002928	666	1523	PF01576	Myosin tail
HMMSmart	IPR001609	1	377	SM00242	Myosin head
	IPR000048	378	400	SM00015	IQ calmodulin-binding region
ProfileScan	IPR000048	380	408	PS50096	IQ calmodulin-binding region

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-