| HUGE |
Gene/Protein Characteristic Table for KIAA2034 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Mapping | |
| Product ID : | ORK06071 |
|---|---|
| Accession No. : | AB111886 |
| Description : | Myosin-14. |
| HUGO Gene Name : | myosin, heavy chain 14 (MYH14) |
| Clone Name : | ah04445 [Vector Info] |
| Flexi ORF Clone : | pF1KA2034
|
| Source : | Human brain (amygdala) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5472 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 755 bp Genome contig ID gi42406306f_55344121 PolyA signal sequence
(AATAAA,-27)
CTGGCAGAAATAAACTCCAACCCGACTGGACCATCFlanking genome sequence
(161495 - 161544)
TCTGTGGCTGTGTGTGTTCCTGCAGGGGGTCTCTGATGGGGCAGGATGGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 19 f 55444121 55505614 31 99.8 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1571 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
|---|---|---|
| : 19 |
| : genbank | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
