HUGE |
Gene/Protein Characteristic Table for KIAA0216 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01591 |
---|---|
Accession No. : | D86970 |
Description : | Myosin-XVIIIa. |
HUGO Gene Name : | myosin XVIIIA (MYO18A) |
Clone Name : | hf00331s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0216
![]() |
Source : | Human adult brain |
Note : | We replaced ha04661, former representative clones for KIAA0216 with hf00331s1. (2002/12/27) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7597 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1251 bp Genome contig ID gi51511734r_24324663 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
CGATGTATGGAAATAAAGGCCCTTTTCCTCCTGGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
TGCGCCAGTTTTCCTGCCTGTTCCTTCAGGCTCAGGCAAAGTCTGGATTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 r 24424663 24531556 41 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2067 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 17 |
: Genebridge 4 | |
: ACTTATCCCAGACACAACACC | |
: CGGGTAAACAGGGGAGAGCAC | |
: 186 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |