HUGE

Gene/Protein Characteristic Table for KIAA0216

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01591
Accession No. :	D86970
Description :	Myosin-XVIIIa.
HUGO Gene Name :	myosin XVIIIA (MYO18A)
Clone Name :	hf00331s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0216
Source :	Human adult brain
Note :	We replaced ha04661, former representative clones for KIAA0216 with hf00331s1. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 7597 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1251 bp

Genome contig ID gi51511734r_24324663
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
CGATGTATGGAAATAAAGGCCCTTTTCCTCCTGGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TGCGCCAGTTTTCCTGCCTGTTCCTTCAGGCTCAGGCAAAGTCTGGATTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 24424663 24531556 41 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 2067 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92614	100.0	Myosin-XVIIIa; ...	Homo sapiens
EAW51184	99.6	hCG27198, isofo...	Homo sapiens
XP_001110808	99.2	similar to myos...	Macaca mulatta
XP_854225	96.2	similar to myos...	Canis lupus fam...
XP_001080824	94.7	similar to myos...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020673	1.1e-19	28.1	KIAA0866
AB111886	4.1e-19	26.5	KIAA2034
AB023217	6.2e-17	27.3	KIAA1000
AB040945	1.9e-12	28.2	KIAA1512
AB032945	7.9e-10	23.4	KIAA1119

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom NULL 1277 1620 PD360721 NULL

FPrintScan IPR001609 448 467 PR00193 Myosin head

IPR001609 504 529 PR00193 Myosin head

IPR001609 550 577 PR00193 Myosin head

IPR001609 803 831 PR00193 Myosin head

HMMPfam IPR001478 233 321 PF00595 PDZ/DHR/GLGF

IPR001609 420 628 PF00063 Myosin head

IPR001609 652 726 PF00063 Myosin head

IPR001609 766 854 PF00063 Myosin head

IPR001609 1099 1186 PF00063 Myosin head

IPR000048 1202 1222 PF00612 IQ calmodulin-binding region

HMMSmart IPR001478 242 324 SM00228 PDZ/DHR/GLGF

IPR001609 412 1199 SM00242 Myosin head

IPR000048 1200 1222 SM00015 IQ calmodulin-binding region

ProfileScan IPR001478 233 324 PS50106 PDZ/DHR/GLGF

IPR001553 555 620 PS50163 RecA bacterial DNA recombination

IPR000048 1201 1230 PS50096 IQ calmodulin-binding region

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	1277	1620	PD360721	NULL
FPrintScan	IPR001609	448	467	PR00193	Myosin head
IPR001609	504	529	PR00193	Myosin head
IPR001609	550	577	PR00193	Myosin head
IPR001609	803	831	PR00193	Myosin head
HMMPfam	IPR001478	233	321	PF00595	PDZ/DHR/GLGF
IPR001609	420	628	PF00063	Myosin head
IPR001609	652	726	PF00063	Myosin head
IPR001609	766	854	PF00063	Myosin head
IPR001609	1099	1186	PF00063	Myosin head
IPR000048	1202	1222	PF00612	IQ calmodulin-binding region
HMMSmart	IPR001478	242	324	SM00228	PDZ/DHR/GLGF
IPR001609	412	1199	SM00242	Myosin head
IPR000048	1200	1222	SM00015	IQ calmodulin-binding region
ProfileScan	IPR001478	233	324	PS50106	PDZ/DHR/GLGF
IPR001553	555	620	PS50163	RecA bacterial DNA recombination
IPR000048	1201	1230	PS50096	IQ calmodulin-binding region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: ACTTATCCCAGACACAACACC
Primer_r	: CGGGTAAACAGGGGAGAGCAC
PCR product length	: 186 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1251 bp
Genome contig ID	gi51511734r_24324663
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- CGATGTATGGAAATAAAGGCCCTTTTCCTCCTGGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGCGCCAGTTTTCCTGCCTGTTCCTTCAGGCTCAGGCAAAGTCTGGATTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	24424663	24531556	41	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0216

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information