HUGE

Gene/Protein Characteristic Table for KIAA1512

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06072
Accession No. :	AB040945
Description :	myosin, heavy polypeptide 7B, cardiac muscle, beta.
HUGO Gene Name :	myosin, heavy chain 7B, cardiac muscle, beta (MYH7B)
Clone Name :	fg04660y1 [Vector Info]
Flexi ORF Clone :	pF1KA1512
Source :	Human fetal brain
Note :	We replaced fg04660, former representative clones for KIAA1512 with fg04660y1. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 6289 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 245 bp

Genome contig ID gi51511747f_32929096
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
AGCAGTCATTTTTAAAATAAAGTTATTTAATAGTC
Flanking genome sequence
(124803 - 124852)
----+----*----+----*----+----*----+----*----+----*
TCCATTTAATTGGTTTATTTGCTGTTAATAAATTGGCAACACAAGGAAGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 f 33026867 33053897 43 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 2010 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI51243	100.0	Myosin, heavy c...	Homo sapiens
CAI19310	100.0	myosin, heavy c...	Homo sapiens
XP_001160839	99.9	myosin, heavy p...	Pan troglodytes
A7E2Y1	100.0	Myosin-7B; Myos...	Homo sapiens
XP_001160798	99.7	myosin, heavy p...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023217	1.4e-155	60.6	KIAA1000
AB020673	1.7e-104	40.4	KIAA0866
AB111886	4.5e-53	36.8	KIAA2034
AB032945	4e-34	30.4	KIAA1119
AB018270	6.4e-25	32.1	KIAA0727

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001609 289 319 PD000355 Myosin head

FPrintScan IPR001609 183 202 PR00193 Myosin head

IPR001609 239 264 PR00193 Myosin head

IPR001609 297 324 PR00193 Myosin head

IPR001609 528 556 PR00193 Myosin head

IPR001609 582 610 PR00193 Myosin head

HMMPfam IPR004009 101 143 PF02736 Myosin

IPR001609 155 842 PF00063 Myosin head

IPR000048 858 878 PF00612 IQ calmodulin-binding region

IPR002928 1144 2002 PF01576 Myosin tail

HMMSmart IPR001609 147 855 SM00242 Myosin head

ProfileScan IPR000048 857 886 PS50096 IQ calmodulin-binding region

ScanRegExp IPR000169 404 414 PS00639 Peptidase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001609	289	319	PD000355	Myosin head
FPrintScan	IPR001609	183	202	PR00193	Myosin head
IPR001609	239	264	PR00193	Myosin head
IPR001609	297	324	PR00193	Myosin head
IPR001609	528	556	PR00193	Myosin head
IPR001609	582	610	PR00193	Myosin head
HMMPfam	IPR004009	101	143	PF02736	Myosin
IPR001609	155	842	PF00063	Myosin head
IPR000048	858	878	PF00612	IQ calmodulin-binding region
IPR002928	1144	2002	PF01576	Myosin tail
HMMSmart	IPR001609	147	855	SM00242	Myosin head
ProfileScan	IPR000048	857	886	PS50096	IQ calmodulin-binding region
ScanRegExp	IPR000169	404	414	PS00639	Peptidase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCACGAGGAGGCACTTGAAGC

Primer_r
: AGCCTGGATCTCACTCTTCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCCTCAACCTTCTGCATTCGC
Primer_r	: GTCTTCTTCATCCGTTCCAGG
PCR product length	: 220(370) bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	245 bp
Genome contig ID	gi51511747f_32929096
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AGCAGTCATTTTTAAAATAAAGTTATTTAATAGTC
Flanking genome sequence (124803 - 124852)	----+--------+--------+--------+--------+----* TCCATTTAATTGGTTTATTTGCTGTTAATAAATTGGCAACACAAGGAAGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	f	33026867	33053897	43	99.8	Perfect prediction

Primer_f	: CCACGAGGAGGCACTTGAAGC
Primer_r	: AGCCTGGATCTCACTCTTCTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1512

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information