HUGE

Gene/Protein Characteristic Table for KIAA0727

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01115
Accession No. :	AB018270
Description :	Myosin-Id.
HUGO Gene Name :	myosin ID (MYO1D)
Clone Name :	hk03490y1 [Vector Info]
Flexi ORF Clone :	pF1KA0727
Source :	Human adult brain
Note :	We replaced hk03490, former representative clones for KIAA0727 with hk03490y1. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 5182 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2149 bp

Genome contig ID gi51511734r_27743741
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
GATTTGCCATCAAGAGCAATAAAGCATTAAATCTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTTTAAAGGTGTTCTGCTTATCTGTCACTGAAAACTTGGTGAAATTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 27843741 28228015 22 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1010 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW80221	100.0	myosin ID, isof...	Homo sapiens
XP_511404	99.6	myosin ID [Pan ...	Pan troglodytes
O94832	100.0	Myosin-Id.	Homo sapiens
XP_548273	98.4	similar to Myos...	Canis lupus fam...
Q63357	98.0	Myosin-Id; Myos...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023217	5.4e-81	33.6	KIAA1000
AB020673	1e-74	35.8	KIAA0866
AB040945	9e-70	32.3	KIAA1512
AB032945	6.1e-69	34.5	KIAA1119
AB018342	4e-58	35.2	KIAA0799

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001609 142 169 PD000355 Myosin head

FPrintScan IPR001609 43 62 PR00193 Myosin head

IPR001609 99 124 PR00193 Myosin head

IPR001609 147 174 PR00193 Myosin head

IPR001609 382 410 PR00193 Myosin head

IPR001609 435 463 PR00193 Myosin head

HMMPfam IPR001609 17 686 PF00063 Myosin head

IPR000048 703 723 PF00612 IQ calmodulin-binding region

IPR000048 725 745 PF00612 IQ calmodulin-binding region

IPR010926 806 1009 PF06017 Myosin tail 2

HMMSmart IPR001609 7 700 SM00242 Myosin head

IPR000048 701 723 SM00015 IQ calmodulin-binding region

ProfileScan IPR000048 702 730 PS50096 IQ calmodulin-binding region

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001609	142	169	PD000355	Myosin head
FPrintScan	IPR001609	43	62	PR00193	Myosin head
IPR001609	99	124	PR00193	Myosin head
IPR001609	147	174	PR00193	Myosin head
IPR001609	382	410	PR00193	Myosin head
IPR001609	435	463	PR00193	Myosin head
HMMPfam	IPR001609	17	686	PF00063	Myosin head
IPR000048	703	723	PF00612	IQ calmodulin-binding region
IPR000048	725	745	PF00612	IQ calmodulin-binding region
IPR010926	806	1009	PF06017	Myosin tail 2
HMMSmart	IPR001609	7	700	SM00242	Myosin head
IPR000048	701	723	SM00015	IQ calmodulin-binding region
ProfileScan	IPR000048	702	730	PS50096	IQ calmodulin-binding region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGTGGCAACTGCAAAAGGATC

Primer_r
: GTCTACAATCATGCCCGCTTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGTGGCAACTGCAAAAGGATC
Primer_r	: GTCTACAATCATGCCCGCTTC
PCR product length	: 93 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2149 bp
Genome contig ID	gi51511734r_27743741
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GATTTGCCATCAAGAGCAATAAAGCATTAAATCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTTTAAAGGTGTTCTGCTTATCTGTCACTGAAAACTTGGTGAAATTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	27843741	28228015	22	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0727

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information