HUGE

Gene/Protein Characteristic Table for KIAA0799

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01122
Accession No. :	AB018342
Description :	Myosin-X.
HUGO Gene Name :	myosin X (MYO10)
Clone Name :	fg01615y1 [Vector Info]
Flexi ORF Clone :	pF1KA0799
Source :	Human fetal brain
Note :	We replaced hg01449, former representative clones for KIAA0799 with fg01615y1. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 8020 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1388 bp

Genome contig ID gi51511721r_16618413
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
GCTCACAGAAGTTCTGACAATAAAAGATACTAGCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACACGCTGTGTGTTTCCTTTATCAGAGGAGGCTCTAAAAACCATGGAGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 r 16718413 16989372 40 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 2111 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001175408	97.9	myosin X [Pan t...	Pan troglodytes
AAI50286	100.0	Myosin X [Homo ...	Homo sapiens
Q9HD67	100.0	Myosin-X; Uncon...	Homo sapiens
AAF37875	100.0	myosin X [Homo ...	Homo sapiens
AAF68025	99.9	myosin X [Homo ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032945	4.9e-30	34.2	KIAA1119
AB020673	1.4e-25	34.0	KIAA0866
AB040945	1.7e-24	33.4	KIAA1512
AB023217	1.2e-22	32.4	KIAA1000
AB018270	1.1e-20	35.1	KIAA0727

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001609 247 281 PD000355 Myosin head

FPrintScan IPR001609 146 165 PR00193 Myosin head

IPR001609 203 228 PR00193 Myosin head

IPR001609 255 282 PR00193 Myosin head

IPR001609 482 510 PR00193 Myosin head

IPR001609 535 563 PR00193 Myosin head

HMMPfam IPR001609 118 780 PF00063 Myosin head

IPR000048 796 816 PF00612 IQ calmodulin-binding region

IPR000048 819 839 PF00612 IQ calmodulin-binding region

IPR000048 842 862 PF00612 IQ calmodulin-binding region

IPR001849 1266 1363 PF00169 Pleckstrin-like

IPR001849 1446 1550 PF00169 Pleckstrin-like

IPR000857 1636 1748 PF00784 Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4

IPR000159 1751 1806 PF00788 Ras-association

HMMSmart IPR001609 110 793 SM00242 Myosin head

IPR000048 794 816 SM00015 IQ calmodulin-binding region

IPR000048 817 839 SM00015 IQ calmodulin-binding region

IPR000048 840 862 SM00015 IQ calmodulin-binding region

IPR001849 1266 1365 SM00233 Pleckstrin-like

IPR001849 1446 1552 SM00233 Pleckstrin-like

IPR000857 1600 1748 SM00139 Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4

IPR000299 1749 2011 SM00295 Band 4.1

ProfileScan IPR000048 796 819 PS50096 IQ calmodulin-binding region

IPR000048 841 870 PS50096 IQ calmodulin-binding region

IPR001849 1265 1363 PS50003 Pleckstrin-like

IPR001849 1445 1550 PS50003 Pleckstrin-like

IPR000857 1600 1748 PS51016 Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4

IPR000299 1753 2097 PS50057 Band 4.1

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001609	247	281	PD000355	Myosin head
FPrintScan	IPR001609	146	165	PR00193	Myosin head
IPR001609	203	228	PR00193	Myosin head
IPR001609	255	282	PR00193	Myosin head
IPR001609	482	510	PR00193	Myosin head
IPR001609	535	563	PR00193	Myosin head
HMMPfam	IPR001609	118	780	PF00063	Myosin head
IPR000048	796	816	PF00612	IQ calmodulin-binding region
IPR000048	819	839	PF00612	IQ calmodulin-binding region
IPR000048	842	862	PF00612	IQ calmodulin-binding region
IPR001849	1266	1363	PF00169	Pleckstrin-like
IPR001849	1446	1550	PF00169	Pleckstrin-like
IPR000857	1636	1748	PF00784	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
IPR000159	1751	1806	PF00788	Ras-association
HMMSmart	IPR001609	110	793	SM00242	Myosin head
IPR000048	794	816	SM00015	IQ calmodulin-binding region
IPR000048	817	839	SM00015	IQ calmodulin-binding region
IPR000048	840	862	SM00015	IQ calmodulin-binding region
IPR001849	1266	1365	SM00233	Pleckstrin-like
IPR001849	1446	1552	SM00233	Pleckstrin-like
IPR000857	1600	1748	SM00139	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
IPR000299	1749	2011	SM00295	Band 4.1
ProfileScan	IPR000048	796	819	PS50096	IQ calmodulin-binding region
IPR000048	841	870	PS50096	IQ calmodulin-binding region
IPR001849	1265	1363	PS50003	Pleckstrin-like
IPR001849	1445	1550	PS50003	Pleckstrin-like
IPR000857	1600	1748	PS51016	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
IPR000299	1753	2097	PS50057	Band 4.1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CGTGTGGGTAGACTTAGTTGG

Primer_r
: ATAATGGTGGTCTGAACAAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: UniGene
Primer_f	: CGTGTGGGTAGACTTAGTTGG
Primer_r	: ATAATGGTGGTCTGAACAAGG
PCR product length	: 134 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1388 bp
Genome contig ID	gi51511721r_16618413
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- GCTCACAGAAGTTCTGACAATAAAAGATACTAGCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACACGCTGTGTGTTTCCTTTATCAGAGGAGGCTCTAAAAACCATGGAGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	r	16718413	16989372	40	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0799

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information