HUGE |
Gene/Protein Characteristic Table for KIAA1319 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01159 |
---|---|
Accession No. : | AB037740 |
Description : | Cingulin. |
HUGO Gene Name : | cingulin (CGN) |
Clone Name : | fh13717 [Vector Info] |
Flexi ORF Clone : | pF1KA1319
![]() |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5073 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1344 bp Genome contig ID gi89161185f_149657605 PolyA signal sequence
(ATTAAA,-23) +----*----+----*----+----*----+----
TTTAAATTAAATATTAAAATTACACATTTATATTGFlanking genome sequence
(120186 - 120235) ----+----*----+----*----+----*----+----*----+----*
AAATCCTTGGTTTGTCTTCTCATTCTTTTTCTTGGCATATTTGGAGGTCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 149750519 149777789 21 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1208 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TCCCAGAATCAGTTGTTGCAG | |
: GTCCAGTCGCTCAATTTCCTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 1 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |