HUGE

Gene/Protein Characteristic Table for KIAA1319

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01159
Accession No. :	AB037740
Description :	Cingulin.
HUGO Gene Name :	cingulin (CGN)
Clone Name :	fh13717 [Vector Info]
Flexi ORF Clone :	pF1KA1319
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5073 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1344 bp

Genome contig ID gi89161185f_149657605
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
TTTAAATTAAATATTAAAATTACACATTTATATTG
Flanking genome sequence
(120186 - 120235)
----+----*----+----*----+----*----+----*----+----*
AAATCCTTGGTTTGTCTTCTCATTCTTTTTCTTGGCATATTTGGAGGTCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 149750519 149777789 21 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1208 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAF74498	100.0	cingulin [Homo ...	Homo sapiens
Q9P2M7	100.0	Cingulin.	Homo sapiens
XP_513800	99.1	cingulin [Pan t...	Pan troglodytes
XP_001108356	97.3	similar to cing...	Macaca mulatta
ABY40800	97.5	cingulin (predi...	Papio anubis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051536	5.8e-34	33.2	KIAA1749
AB020673	3.7e-15	27.6	KIAA0866
AB111886	5.3e-14	26.0	KIAA2034
AB040945	5.2e-09	24.2	KIAA1512
AB028975	1.2e-05	24.6	KIAA1052

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002928 972 1142 PF01576 Myosin tail

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002928	972	1142	PF01576	Myosin tail

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCCCAGAATCAGTTGTTGCAG

Primer_r
: GTCCAGTCGCTCAATTTCCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1344 bp
Genome contig ID	gi89161185f_149657605
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- TTTAAATTAAATATTAAAATTACACATTTATATTG
Flanking genome sequence (120186 - 120235)	----+--------+--------+--------+--------+----* AAATCCTTGGTTTGTCTTCTCATTCTTTTTCTTGGCATATTTGGAGGTCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	149750519	149777789	21	99.6	Perfect prediction

Primer_f	: TCCCAGAATCAGTTGTTGCAG
Primer_r	: GTCCAGTCGCTCAATTTCCTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1319

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information