HUGE

Gene/Protein Characteristic Table for KIAA1052

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00724
Accession No. :	AB028975
Description :	centrosomal protein 164kDa.
HUGO Gene Name :	centrosomal protein 164kDa (CEP164)
Clone Name :	hh04964 [Vector Info]
Flexi ORF Clone :	pF1KSDA1052
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5817 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1456 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09950	100.0	centrosomal pro...	synthetic construct
EAW67321	99.9	centrosomal pro...	Homo sapiens
EAW67319	99.3	centrosomal pro...	Homo sapiens
Q9UPV0	99.2	Centrosomal pro...	Homo sapiens
EAW67320	99.1	centrosomal pro...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037740	3.6e-05	24.3	KIAA1319
AB007914	0.00021	25.0	KIAA0445
AB111886	0.00065	25.9	KIAA2034
AB032993	0.00081	23.9	KIAA1167

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001202 59 88 PF00397 WW/Rsp5/WWP

HMMSmart IPR001202 58 90 SM00456 WW/Rsp5/WWP

ProfileScan IPR001202 57 90 PS50020 WW/Rsp5/WWP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001202	59	88	PF00397	WW/Rsp5/WWP
HMMSmart	IPR001202	58	90	SM00456	WW/Rsp5/WWP
ProfileScan	IPR001202	57	90	PS50020	WW/Rsp5/WWP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTGCCTGCCTTCTTCCATCTG

Primer_r
: ACAAGTCCACACATTTTAGCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTGCCTGCCTTCTTCCATCTG
Primer_r	: ACAAGTCCACACATTTTAGCC
PCR product length	: 146 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA1052

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information