HUGE

Gene/Protein Characteristic Table for KIAA0445

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK04634
Accession No. :	AB007914
Description :	Rootletin.
HUGO Gene Name :
Clone Name :	hg00102s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hg00102, former representative clones for KIAA0445 with hg00102s1. (2003/4/2)

Features of the cloned DNA sequence	Description

Length: 6281 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 519 bp

Genome contig ID gi89161185f_17023503
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTGTTTTTTGTAACAAAACCTTGTTTTTAAAAAAG
Flanking genome sequence
(148546 - 148595)
----+----*----+----*----+----*----+----*----+----*
TTTGTACAGCTGTGTCCCTTTTCTAGACAATTGGAGGAGACGTCGGGGGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 17123503 17172047 35 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1919 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5TZA2	100.0	Rootletin; Cili...	Homo sapiens
DAA05505	100.0	TPA_exp: rootle...	Homo sapiens
XP_513109	99.1	ciliary rootlet...	Pan troglodytes
CAH70057	97.7	ciliary rootlet...	Homo sapiens
Q8CJ40	83.6	Rootletin; Cili...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067509	4.4e-30	91.7	KIAA1922
AB020673	8.3e-11	24.3	KIAA0866
AB040945	8.4e-09	25.6	KIAA1512
AB111886	3.2e-08	25.7	KIAA2034
AB051536	1.7e-06	26.6	KIAA1749

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTGAGCACTCTGAGGAATTTC
Primer_r	: GCATGGGATCGTGGGAAAGAG
PCR product length	: 135 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	519 bp
Genome contig ID	gi89161185f_17023503
PolyA signal sequence (None)	+--------+--------+----*----+---- CTGTTTTTTGTAACAAAACCTTGTTTTTAAAAAAG
Flanking genome sequence (148546 - 148595)	----+--------+--------+--------+--------+----* TTTGTACAGCTGTGTCCCTTTTCTAGACAATTGGAGGAGACGTCGGGGGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	17123503	17172047	35	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0445

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information