HUGE

Gene/Protein Characteristic Table for KIAA1922

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04635
Accession No. :	AB067509
Description :
HUGO Gene Name :	ciliary rootlet coiled-coil, rootletin-like 2 (CROCCL2)
Clone Name :	fh11169 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5369 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2699 bp

Genome contig ID gi89161185r_16566518
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
AGAAGCATTAAATAAACGCTGTAATTTAAAATGGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACATCCCATTCTCTACACTACAGAAATATCTGCAGGAGTGACCAAAGATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 16666518 16691783 15 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 370 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8IVE0	1.4e-83	100.0	Ciliary rootlet...	Homo sapiens
AAI26913	1.3e-59	91.7	CROCC protein [...	Homo sapiens
AAI26912	1.3e-59	91.7	CROCC protein [...	Homo sapiens
CAH70057	1.8e-59	91.7	ciliary rootlet...	Homo sapiens
Q5TZA2	1.8e-59	91.7	Rootletin; Cili...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007914	5.9e-34	91.7	KIAA0445

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCTTCCGTTCCCTTATAGTAG

Primer_r
: TATGCAGCCAGGATGAAATTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2699 bp
Genome contig ID	gi89161185r_16566518
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- AGAAGCATTAAATAAACGCTGTAATTTAAAATGGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACATCCCATTCTCTACACTACAGAAATATCTGCAGGAGTGACCAAAGATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	16666518	16691783	15	99.2	Perfect prediction

Primer_f	: GCTTCCGTTCCCTTATAGTAG
Primer_r	: TATGCAGCCAGGATGAAATTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1922

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information