HUGE

Gene/Protein Characteristic Table for KIAA0004

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05795
Accession No. :	D13629
Description :	Kinectin.
HUGO Gene Name :	kinectin 1 (kinesin receptor) (KTN1)
Clone Name :	ha00065 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 4457 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 471 bp

Genome contig ID gi51511730f_55016789
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TAATGGCGTCACAAATAAAAGGATGCTTATTATTC
Flanking genome sequence
(204260 - 204309)
----+----*----+----*----+----*----+----*----+----*
AAACTTGACTTGTTCTAATTTTTATTGAGCTTTAACAGATTTCATTAGTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 55116711 55221047 43 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1307 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAB65853	99.9	CG1 protein.	Homo sapiens
AAI51336	88.6	KTN1 protein [B...	Bos taurus
AAI17133	96.0	Kinectin 1 (kin...	Homo sapiens
BAG64000	97.7	unnamed protein...	Homo sapiens
Q86UP2	95.7	Kinectin; Kines...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037819	1.9e-11	26.3	KIAA1398
AB014535	5.4e-07	23.7	KIAA0635
AB046781	7.9e-07	22.5	KIAA1561
AB020673	1.6e-06	22.2	KIAA0866
AB011140	2.9e-06	21.3	KIAA0568

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

None - - - - -

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 14 AYFIVLIPPIVITVIFLFFWLFM 36 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	14	AYFIVLIPPIVITVIFLFFWLFM	36	PRIMARY	23

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TTTTGTCTTTTCTAATCCTT
Primer_r	: TCAGGAATGTAAAGGTCTAA
PCR product length	: 129 bp
PCR conditions	: 95 °C15 sec52 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	471 bp
Genome contig ID	gi51511730f_55016789
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TAATGGCGTCACAAATAAAAGGATGCTTATTATTC
Flanking genome sequence (204260 - 204309)	----+--------+--------+--------+--------+----* AAACTTGACTTGTTCTAATTTTTATTGAGCTTTAACAGATTTCATTAGTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	55116711	55221047	43	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0004

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information